From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2572 [new locus tag: SACOL_RS13475 ]
  • pan locus tag?: SAUPAN006220000
  • symbol: SACOL2572
  • pan gene symbol?: copA
  • synonym:
  • product: copper-translocating P-type ATPase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2572 [new locus tag: SACOL_RS13475 ]
  • symbol: SACOL2572
  • product: copper-translocating P-type ATPase
  • replicon: chromosome
  • strand: +
  • coordinates: 2633237..2635645
  • length: 2409
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    GTGGCTAATACGAAAAAAACAACATTAGATATCACTGGTATGACTTGTGCCGCATGTTCA
    AATCGTATCGAAAAGAAACTGAATAAACTTGATGACGTTAATGCCCAAGTGAATTTAACT
    ACAGAGAAAGCAACTGTTGAGTATAACCCTGATCAACATGATGTCCAAGAATTTATTAAT
    ACGATTCAACATTTAGGTTACGGTGTCGCTGTAGAAACTGTCGAATTAGACATTACAGGT
    ATGACTTGTGCTGCATGCTCAAGCCGTATTGAAAAAGTGTTAAATAAAATGGACGGCGTT
    CAAAATGCAACGGTCAATTTAACAACAGAGCAAGCTAAAGTTGACTATTATCCTGAAGAA
    ACAGATGCTGATAAACTTGTCACTCGCATTCAAAAATTAGGTTATGACGCGTCTATTAAA
    GATAACAATAAAGATCAAACGTCACGCAAAGCTGAAGCGCTACAACATAAATTGATTAAG
    CTTATCATATCAGCAGTATTATCTTTACCACTATTAATGTTAATGTTTGTACATCTTTTC
    AATATGCATATACCAGCACTATTTACGAATCCATGGTTCCAATTTATTTTAGCTACACCT
    GTACAATTTATTATTGGATGGCAATTTTATGTAGGTGCTTATAAAAACTTAAGAAATGGT
    GGCGCCAATATGGATGTACTTGTTGCTGTTGGTACAAGTGCAGCATATTTTTACAGTATT
    TATGAAATGGTTCGTTGGCTAAATGGCTCAACAACGCAACCGCATTTATACTTTGAAACA
    AGCGCCGTACTAATTACCTTAATCTTATTCGGTAAGTATTTAGAAGCTAGAGCGAAGTCT
    CAAACAACCAATGCGCTTGGCGAATTATTAAGTTTACAAGCTAAAGAAGCACGCATTTTA
    AAAGATGGTAATGAAGTGATGATTCCTCTAAATGAAGTACATGTTGGAGATACACTTATC
    GTTAAACCAGGTGAAAAGATACCTGTTGATGGCAAAATTATTAAAGGTATGACTGCCATC
    GACGAATCTATGTTAACAGGTGAATCTATCCCTGTTGAGAAGAATGTTGATGATACTGTA
    ATTGGTTCAACGATGAACAAAAACGGTACTATTACTATGACAGCAACAAAAGTTGGCGGG
    GACACCGCGTTGGCAAATATTATTAAAGTTGTCGAAGAAGCTCAAAGTTCTAAAGCGCCG
    ATTCAACGATTGGCAGATATTATTTCTGGTTATTTCGTTCCTATCGTTGTTGGTATCGCA
    CTATTAACATTTATCGTGTGGATTACTTTAGTTACACCAGGTACATTTGAACCTGCACTT
    GTTGCGAGTATTTCCGTTCTCGTCATTGCTTGTCCATGCGCATTGGGACTTGCTACACCA
    ACTTCTATTATGGTAGGTACTGGTCGCGCTGCTGAAAATGGTATTTTATTTAAAGGTGGC
    GAGTTTGTTGAACGCACACATCAAATTGATACCATCGTTTTAGATAAGACGGGTACCATT
    ACAAATGGTCGTCCAGTCGTGACAGATTATCATGGTGACAATCAAACGCTACAACTACTT
    GCTACTGCTGAAAAAGATTCTGAACACCCATTGGCAGAAGCCATTGTCAATTATGCAAAA
    GAAAAGCAATTAATATTAACTGAGACAACAACATTTAAAGCAGTACCTGGCCATGGTATT
    GAAGCAACGATTGATCATCACCATATATTGGTTGGTAACCGTAAATTAATGGCTGACAAT
    GATATTAGCTTGCCTAAGCATATTTCTGATGATTTAACACATTATGAACGAGATGGTAAA
    ACTGCTATGCTCATTGCTGTTAATTATTCATTAACTGGTATCATCGCAGTGGCAGATACT
    GTCAAAGATCATGCCAAAGATGCTATAAAACAATTGCATGATATGGGCATTGAAGTTGCC
    ATGTTAACTGGCGATAATAAAAACACTGCTCAAGCCATTGCAAAACAAGTAGGCATAGAT
    ACTGTTATTGCAGATATTTTACCAGAAGAAAAAGCTGCACAAATTGCGAAACTACAGCAA
    CAAGGTAAGAAGGTTGCGATGGTTGGTGACGGTGTAAATGATGCACCTGCATTAGTTAAA
    GCTGATATCGGTATCGCCATTGGTACAGGTACAGAAGTTGCCATTGAAGCAGCTGATATT
    ACTATTCTTGGTGGCGACTTGATGCTTATTCCTAAAGCCATTTATGCAAGTAAAGCAACC
    ATTCGTAATATTCGTCAAAATCTATTTTGGGCATTCGGCTATAATATTGCCGGTATCCCT
    ATAGCTGCATTGGGCTTACTTGCGCCATGGGTTGCTGGTGCTGCAATGGCACTAAGTTCA
    GTAAGTGTTGTCACAAACGCACTTAGATTGAAAAAGATGCGATTAGAACCACGCCGTAAA
    GATGCCTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2409

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2572 [new locus tag: SACOL_RS13475 ]
  • symbol: SACOL2572
  • description: copper-translocating P-type ATPase
  • length: 802
  • theoretical pI: 6.15296
  • theoretical MW: 86743.8
  • GRAVY: 0.107481

Function[edit source | edit]

  • reaction:
    EC 3.6.3.54?  ExPASy
    Cu+ exporting ATPaseATP + H2O + Cu+(Side 1) = ADP + phosphate + Cu+(Side 2)
  • TIGRFAM:
    heavy metal translocating P-type ATPase (TIGR01525; EC 3.6.3.-; HMM-score: 671.6)
    Cellular processesCellular processesDetoxificationcopper-translocating P-type ATPase (TIGR01511; EC 3.6.3.4; HMM-score: 633.6)
    MetabolismTransport and binding proteinsCations and iron carrying compoundscopper-translocating P-type ATPase (TIGR01511; EC 3.6.3.4; HMM-score: 633.6)
    MetabolismTransport and binding proteinsCations and iron carrying compoundscadmium-translocating P-type ATPase (TIGR01512; EC 3.6.3.3; HMM-score: 426.6)
    HAD ATPase, P-type, family IC (TIGR01494; EC 3.6.3.-; HMM-score: 326.1)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsK+-transporting ATPase, B subunit (TIGR01497; EC 3.6.3.12; HMM-score: 203.5)
    plasma-membrane proton-efflux P-type ATPase (TIGR01647; EC 3.6.3.6; HMM-score: 186)
    calcium-translocating P-type ATPase, PMCA-type (TIGR01517; EC 3.6.3.8; HMM-score: 159.7)
    calcium-transporting P-type ATPase, PMR1-type (TIGR01522; EC 3.6.3.8; HMM-score: 136.1)
    MetabolismEnergy metabolismATP-proton motive force interconversionNa,H/K antiporter P-type ATPase, alpha subunit (TIGR01106; EC 3.6.3.-; HMM-score: 133.9)
    MetabolismTransport and binding proteinsCations and iron carrying compoundscalcium-translocating P-type ATPase, SERCA-type (TIGR01116; EC 3.6.3.8; HMM-score: 132.2)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsmagnesium-translocating P-type ATPase (TIGR01524; EC 3.6.3.2; HMM-score: 105.8)
    P-type ATPase of unknown pump specificity (type V) (TIGR01657; HMM-score: 102)
    potassium/sodium efflux P-type ATPase, fungal-type (TIGR01523; EC 3.6.3.-; HMM-score: 100)
    MetabolismTransport and binding proteinsCations and iron carrying compoundscopper ion binding protein (TIGR00003; HMM-score: 74.3)
    Cellular processesCellular processesDetoxificationmercuric transport protein periplasmic component (TIGR02052; HMM-score: 63.8)
    Unknown functionEnzymes of unknown specificityCof-like hydrolase (TIGR00099; HMM-score: 38.3)
    MetabolismAmino acid biosynthesisSerine familyphosphoserine phosphatase SerB (TIGR00338; EC 3.1.3.3; HMM-score: 29.3)
    phospholipid-translocating P-type ATPase, flippase (TIGR01652; EC 3.6.3.1; HMM-score: 28.1)
    phosphoserine phosphatase-like hydrolase, archaeal (TIGR01491; HMM-score: 24.1)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharides3-deoxy-D-manno-octulosonate 8-phosphate phosphatase, YrbI family (TIGR01670; EC 3.1.3.45; HMM-score: 23.6)
    phosphoglycolate phosphatase, TA0175-type (TIGR01487; EC 3.1.3.18; HMM-score: 22.9)
    Unknown functionEnzymes of unknown specificityHAD phosphoserine phosphatase-like hydrolase, family IB (TIGR01488; HMM-score: 21.3)
    sucrose-phosphate phosphatase subfamily (TIGR01482; EC 3.1.3.-; HMM-score: 19.2)
    mannosyl-3-phosphoglycerate phosphatase family (TIGR01486; EC 3.1.3.-; HMM-score: 19.1)
    phosphonatase-like hydrolase (TIGR03351; HMM-score: 18.4)
    HAD hydrolase, TIGR01548 family (TIGR01548; HMM-score: 14.7)
    Unknown functionEnzymes of unknown specificityHAD hydrolase, family IB (TIGR01490; HMM-score: 13.1)
    Cellular processesCellular processesPathogenesistype III secretion apparatus lipoprotein, YscJ/HrcJ family (TIGR02544; HMM-score: 11.6)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype III secretion apparatus lipoprotein, YscJ/HrcJ family (TIGR02544; HMM-score: 11.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherFe-S cluster assembly protein NifU (TIGR02000; HMM-score: 11.2)
    MetabolismCentral intermediary metabolismNitrogen fixationFe-S cluster assembly protein NifU (TIGR02000; HMM-score: 11.2)
    Cellular processesCellular processesCell divisionchromosome segregation protein SMC (TIGR02169; HMM-score: 9.9)
    Genetic information processingDNA metabolismChromosome-associated proteinschromosome segregation protein SMC (TIGR02169; HMM-score: 9.9)
  • TheSEED:  
    RespirationElectron accepting reactionsTerminal cytochrome C oxidases Copper-translocating P-type ATPase (EC 3.6.3.4) 
    Virulence, Disease and DefenseResistance to antibiotics and toxic compoundsCopper homeostasis Copper-translocating P-type ATPase (EC 3.6.3.4) 
    CBSS-196620.1.peg.2477 Copper-translocating P-type ATPase (EC 3.6.3.4) 
    CBSS-196620.1.peg.2477 Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5) 
  • PFAM:
    no clan definedE1-E2_ATPase; E1-E2 ATPase (PF00122; HMM-score: 192.8)
    HAD (CL0137) Hydrolase; haloacid dehalogenase-like hydrolase (PF00702; HMM-score: 170)
    no clan definedHMA; Heavy-metal-associated domain (PF00403; HMM-score: 118.6)
    HAD (CL0137) Hydrolase_3; haloacid dehalogenase-like hydrolase (PF08282; HMM-score: 30.2)
    HAD; haloacid dehalogenase-like hydrolase (PF12710; HMM-score: 22.6)
    TusA-like (CL0397) TusA; Sulfurtransferase TusA (PF01206; HMM-score: 22.2)
    HAD (CL0137) Hydrolase_6; haloacid dehalogenase-like hydrolase (PF13344; HMM-score: 18.5)
    HAD_2; haloacid dehalogenase-like hydrolase (PF13419; HMM-score: 16.3)
    GlnB-like (CL0089) DUF190; Uncharacterized ACR, COG1993 (PF02641; HMM-score: 13.1)
    Zn_Beta_Ribbon (CL0167) OrfB_Zn_ribbon; Putative transposase DNA-binding domain (PF07282; HMM-score: 12.2)
    no clan definedDUF2207; Predicted membrane protein (DUF2207) (PF09972; HMM-score: 11.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL0842(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SACOL0731LysR family transcriptional regulator  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0.01
    • Extracellular Score: 0.01
    • Internal Helices: 8
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.192
    • Ymax_pos: 18
    • Cmax: 0.125
    • Cmax_pos: 36
    • Smax: 0.46
    • Smax_pos: 17
    • Smean: 0.322
    • D: 0.243
  • predicted transmembrane helices (TMHMM): 8

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MANTKKTTLDITGMTCAACSNRIEKKLNKLDDVNAQVNLTTEKATVEYNPDQHDVQEFINTIQHLGYGVAVETVELDITGMTCAACSSRIEKVLNKMDGVQNATVNLTTEQAKVDYYPEETDADKLVTRIQKLGYDASIKDNNKDQTSRKAEALQHKLIKLIISAVLSLPLLMLMFVHLFNMHIPALFTNPWFQFILATPVQFIIGWQFYVGAYKNLRNGGANMDVLVAVGTSAAYFYSIYEMVRWLNGSTTQPHLYFETSAVLITLILFGKYLEARAKSQTTNALGELLSLQAKEARILKDGNEVMIPLNEVHVGDTLIVKPGEKIPVDGKIIKGMTAIDESMLTGESIPVEKNVDDTVIGSTMNKNGTITMTATKVGGDTALANIIKVVEEAQSSKAPIQRLADIISGYFVPIVVGIALLTFIVWITLVTPGTFEPALVASISVLVIACPCALGLATPTSIMVGTGRAAENGILFKGGEFVERTHQIDTIVLDKTGTITNGRPVVTDYHGDNQTLQLLATAEKDSEHPLAEAIVNYAKEKQLILTETTTFKAVPGHGIEATIDHHHILVGNRKLMADNDISLPKHISDDLTHYERDGKTAMLIAVNYSLTGIIAVADTVKDHAKDAIKQLHDMGIEVAMLTGDNKNTAQAIAKQVGIDTVIADILPEEKAAQIAKLQQQGKKVAMVGDGVNDAPALVKADIGIAIGTGTEVAIEAADITILGGDLMLIPKAIYASKATIRNIRQNLFWAFGYNIAGIPIAALGLLAPWVAGAAMALSSVSVVTNALRLKKMRLEPRRKDA

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Integral membrane [2] [3]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]