From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2616 [new locus tag: SACOL_RS13685 ]
  • pan locus tag?: SAUPAN006294000
  • symbol: SACOL2616
  • pan gene symbol?: panE
  • synonym:
  • product: 2-dehydropantoate 2-reductase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2616 [new locus tag: SACOL_RS13685 ]
  • symbol: SACOL2616
  • product: 2-dehydropantoate 2-reductase
  • replicon: chromosome
  • strand: +
  • coordinates: 2672486..2673346
  • length: 861
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGTTATCAGTTGCGATTATCGGCCCAGGCGCTGTCGGTACAACTATTGCCTATGAATTA
    CAACAATCATTGCCTCATACAACGCTTATCGGGAGACACGCCAAAACAATAACATATTAT
    ACTGTACCACATGCACCTGCACAAGATATTGTTGTGAAAGGTTATGAAGATGTCACAAAC
    ACATTTGATGTTATTATTATTGCAGTCAAAACACATCAACTTGATGCAGTTATTCCTCAT
    TTAACTCATCTTGCACATGAGGACACGCTCATCATTTTAGCCCAAAATGGTTATGGTCAA
    CTCGAACATATTTCATTTAAAAACGTATGCCAAGCAGTTGTCTATATAAGTGGTCAAAAG
    AAAGGCGATGTTGTTACGCACTTCAGAGATTATCAATTACGTATACAAGATAATGCATTA
    ACTCGACAATTTAGAGATTTGGTCCAAGACAGTCAAATCGACATTGTATTAGAAGCAAAT
    ATTCAACAAGCTATTTGGTATAAATTGTTAGTTAACTTGGGCATTAATTCTATCACAGCA
    CTCGGTAGACAGACCGTTGCAATCATGCATAATCCTGAAATACGTACACTGTGTAGACAG
    CTATTACTAGATGGTTGTCGTGTTGCACAGGCAGAGGGGTTAAACTTTTCAGAACAAACT
    GTCGATACTATTATGACTATATATCAAGGTTATCCCGACGAAATGGGAACGAGCATGTAT
    TACGACATTGCGCATCAGCAACCTCTTGAAGTCGAAGCGATTCAAGGCTTTATTTATCGA
    CGTGCACGTGAACACAATCTTGACACCCCATATCTTGATACTATTTATAGCTTTTTACGC
    GCGTATCAACAAAATATGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    861

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2616 [new locus tag: SACOL_RS13685 ]
  • symbol: SACOL2616
  • description: 2-dehydropantoate 2-reductase
  • length: 286
  • theoretical pI: 6.06642
  • theoretical MW: 32357.7
  • GRAVY: -0.0632867

Function[edit source | edit]

  • reaction:
    EC 1.1.1.169?  ExPASy
    2-dehydropantoate 2-reductase(R)-pantoate + NADP+ = 2-dehydropantoate + NADPH
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPantothenate and coenzyme A2-dehydropantoate 2-reductase (TIGR00745; EC 1.1.1.-; HMM-score: 176)
    MetabolismAmino acid biosynthesisGlutamate familypyrroline-5-carboxylate reductase (TIGR00112; EC 1.5.1.2; HMM-score: 16.2)
  • TheSEED:  
    Cofactors, Vitamins, Prosthetic Groups, PigmentsCoenzyme ACoenzyme A Biosynthesis 2-dehydropantoate 2-reductase (EC 1.1.1.169) 
  • PFAM:
    6PGD_C (CL0106) ApbA_C; Ketopantoate reductase PanE/ApbA C terminal (PF08546; HMM-score: 104.4)
    NADP_Rossmann (CL0063) ApbA; Ketopantoate reductase PanE/ApbA (PF02558; HMM-score: 63.8)
    F420_oxidored; NADP oxidoreductase coenzyme F420-dependent (PF03807; HMM-score: 29.5)
    NAD_Gly3P_dh_N; NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus (PF01210; HMM-score: 25.4)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 16.7)
    NAD_binding_2; NAD binding domain of 6-phosphogluconate dehydrogenase (PF03446; HMM-score: 16)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 15.2)
    Rossmann-like; Rossmann-like domain (PF10727; HMM-score: 14.4)
    IlvN; Acetohydroxy acid isomeroreductase, NADPH-binding domain (PF07991; HMM-score: 14.3)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 11.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.78
    • Cytoplasmic Membrane Score: 8.16
    • Cellwall Score: 0.06
    • Extracellular Score: 0.01
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.202
    • Ymax_pos: 18
    • Cmax: 0.197
    • Cmax_pos: 18
    • Smax: 0.291
    • Smax_pos: 17
    • Smean: 0.205
    • D: 0.203
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MLSVAIIGPGAVGTTIAYELQQSLPHTTLIGRHAKTITYYTVPHAPAQDIVVKGYEDVTNTFDVIIIAVKTHQLDAVIPHLTHLAHEDTLIILAQNGYGQLEHISFKNVCQAVVYISGQKKGDVVTHFRDYQLRIQDNALTRQFRDLVQDSQIDIVLEANIQQAIWYKLLVNLGINSITALGRQTVAIMHNPEIRTLCRQLLLDGCRVAQAEGLNFSEQTVDTIMTIYQGYPDEMGTSMYYDIAHQQPLEVEAIQGFIYRRAREHNLDTPYLDTIYSFLRAYQQNM

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [1] [2] [3]
    quantitative data / protein copy number per cell: 125 [4]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL2616 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  4. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]