From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2634 [new locus tag: SACOL_RS13790 ]
  • pan locus tag?: SAUPAN006321000
  • symbol: nrdG
  • pan gene symbol?: nrdG
  • synonym:
  • product: anaerobic ribonucleoside-triphosphate reductase activating protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2634 [new locus tag: SACOL_RS13790 ]
  • symbol: nrdG
  • product: anaerobic ribonucleoside-triphosphate reductase activating protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2693548..2694084
  • length: 537
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    ATGATACTTTTAGACATTAAACAAGGACAAGGTTATATTGCTAAAATAGAATCAAATAGC
    TTTGTTGACGGTGAAGGAGTAAGATGCAGTGTTTATGTATCAGGATGTCCATTTAATTGT
    GTTGGATGTTATAACAAAGCCTCACAAAAGTTCAGATATGGCGAGAAATACACTGATGAA
    ATATTAGCAGAAATATTAGATGATTGCGATCATGATTATATATCTGGGCTAAGTCTATTA
    GGTGGCGAACCATTTTGTAATTTGGATATTACATTAAATCTTGTCAAAGCATTTCGAGCA
    CGTTTTGGAAATACAAAGACAATTTGGGTATGGACTGGATTTTTATATGAATATTTAGCA
    AATGATTGTACAGAACGTCGAGAGTTATTATCATACATTGACGTTTTAGTAGATGGTCTA
    TTTATACAACACTTATTCAAACCTGATTTACCATATAAAGGTTCTTTAAATCAACGCATT
    ATAGATGTACAACAATCACTCTCGCATGCGCGTATGATTGAATATATAGTTAGTTGA
    60
    120
    180
    240
    300
    360
    420
    480
    537

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2634 [new locus tag: SACOL_RS13790 ]
  • symbol: NrdG
  • description: anaerobic ribonucleoside-triphosphate reductase activating protein
  • length: 178
  • theoretical pI: 4.81826
  • theoretical MW: 20293.1
  • GRAVY: -0.0382022

Function[edit source | edit]

  • reaction:
    EC 1.97.1.-?  ExPASy
  • TIGRFAM:
    Genetic information processingProtein fateProtein modification and repairanaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02491; EC 1.97.1.-; HMM-score: 159.3)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotides2'-Deoxyribonucleotide metabolismanaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02491; EC 1.97.1.-; HMM-score: 159.3)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotides2'-Deoxyribonucleotide metabolismanaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02826; EC 1.97.1.-; HMM-score: 55.6)
    Genetic information processingProtein fateProtein modification and repairpyruvate formate-lyase 1-activating enzyme (TIGR02493; EC 1.97.1.4; HMM-score: 43.3)
    MetabolismEnergy metabolismAnaerobicpyruvate formate-lyase 1-activating enzyme (TIGR02493; EC 1.97.1.4; HMM-score: 43.3)
    glycyl-radical enzyme activating protein (TIGR02494; EC 1.97.1.-; HMM-score: 41.9)
    Genetic information processingProtein fateProtein modification and repairanaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02495; EC 1.97.-.-; HMM-score: 37.2)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotides2'-Deoxyribonucleotide metabolismanaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02495; EC 1.97.-.-; HMM-score: 37.2)
    Genetic information processingProtein fateProtein modification and repairglycine radical enzyme activase, YjjW family (TIGR04041; EC 1.97.1.-; HMM-score: 34.8)
    Genetic information processingProtein fateProtein modification and repair[benzylsuccinate synthase]-activating enzyme (TIGR04003; EC 1.97.-.-; HMM-score: 28.8)
    MetabolismEnergy metabolismAmino acids and aminescholine TMA-lyase-activating enzyme (TIGR04395; EC 1.97.-.-; HMM-score: 25.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminputative heme d1 biosynthesis radical SAM protein NirJ1 (TIGR04054; HMM-score: 19.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminheme d1 biosynthesis radical SAM protein NirJ (TIGR04051; HMM-score: 17)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalamin12,18-didecarboxysiroheme deacetylase (TIGR04546; HMM-score: 15.8)
    pseudo-rSAM protein/SPASM domain protein (TIGR04347; HMM-score: 15.2)
    putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR04349; HMM-score: 14.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMolybdopterinprobable molybdenum cofactor biosynthesis protein A (TIGR02668; HMM-score: 13.2)
    Genetic information processingProtein synthesistRNA and rRNA base modificationputative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR03963; HMM-score: 12.4)
    putative geopeptide radical SAM maturase (TIGR04280; HMM-score: 11.7)
    B12-binding domain/radical SAM domain protein, rhizo-twelve system (TIGR04295; HMM-score: 10.2)
  • TheSEED:  
    Nucleosides and NucleotidesNucleosides and Nucleotides - no subcategoryRibonucleotide reduction Ribonucleotide reductase of class III (anaerobic), activating protein (EC 1.97.1.4) 
  • PFAM:
    4Fe-4S (CL0344) Fer4_12; 4Fe-4S single cluster domain (PF13353; HMM-score: 149.3)
    Fer4_14; 4Fe-4S single cluster domain (PF13394; HMM-score: 91.2)
    TIM_barrel (CL0036) Radical_SAM; Radical SAM superfamily (PF04055; HMM-score: 38.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.15
    • Ymax_pos: 50
    • Cmax: 0.132
    • Cmax_pos: 48
    • Smax: 0.282
    • Smax_pos: 45
    • Smean: 0.122
    • D: 0.139
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MILLDIKQGQGYIAKIESNSFVDGEGVRCSVYVSGCPFNCVGCYNKASQKFRYGEKYTDEILAEILDDCDHDYISGLSLLGGEPFCNLDITLNLVKAFRARFGNTKTIWVWTGFLYEYLANDCTERRELLSYIDVLVDGLFIQHLFKPDLPYKGSLNQRIIDVQQSLSHARMIEYIVS

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: NrdR
    NrdR (TF) important in Deoxyribonucleotide biosynthesis

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]