From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2652 [new locus tag: SACOL_RS13890 ]
  • pan locus tag?: SAUPAN006357000
  • symbol: clfB
  • pan gene symbol?: clfB
  • synonym:
  • product: clumping factor B

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2652 [new locus tag: SACOL_RS13890 ]
  • symbol: clfB
  • product: clumping factor B
  • replicon: chromosome
  • strand: -
  • coordinates: 2711036..2713777
  • length: 2742
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    2461
    2521
    2581
    2641
    2701
    TTGAAAAAAAGAATTGATTATTTGTCGAATAAGCAGAATAAGTATTCGATTAGACGTTTT
    ACAGTAGGTACCACATCAGTAATAGTAGGGGCAACTATACTATTTGGGATAGGCAATCAT
    CAAGCACAAGCTTCAGAACAATCGAACGATACAACGCAATCTTCGAAAAATAATGCAAGT
    GCAGATTCCGAAAAAAACAATATGATAGAAACACCTCAATTAAATACAACGGCTAATGAT
    ACATCTGATATTAGTGCAAACACAAACAGTGCGAATGTAGATAGCACAACAAAACCAATG
    TCTACACAAACGAGCAATACCACTACAACAGAGCCAGCTTCAACAAATGAAACACCTCAA
    CCGACGGCAATTAAAAATCAAGCAACTGCTGCAAAAATGCAAGATCAAACTGTTCCTCAA
    GAAGCAAATTCTCAAGTAGATAATAAAACAACGAATGATGCTAATAGCATAGCAACAAAC
    AGTGAGCTTAAAAATTCTCAAACATTAGATTTACCACAATCATCACCACAAACGATTTCC
    AATGCGCAAGGAACTAGTAAACCAAGTGTTAGAACGAGAGCTGTACGTAGTTTAGCTGTT
    GCTGAACCGGTAGTAAATGCTGCTGATGCTAAAGGTACAAATGTAAATGATAAAGTTACG
    GCAAGTAATTTCAAGTTAGAAAAGACTACATTTGACCCTAATCAAAGTGGTAACACATTT
    ATGGCGGCAAATTTTACAGTGACAGATAAAGTGAAATCAGGGGATTATTTTACAGCGAAG
    TTACCAGATAGTTTAACTGGTAATGGAGACGTGGATTATTCTAATTCAAATAATACGATG
    CCAATTGCAGACATTAAAAGTACGAATGGCGATGTTGTAGCTAAAGCAACATATGATATC
    TTGACTAAGACGTATACATTTGTCTTTACAGATTATGTAAATAATAAAGAAAATATTAAC
    GGACAATTTTCATTACCTTTATTTACAGACCGAGCAAAGGCACCTAAATCAGGAACATAT
    GATGCGAATATTAATATTGCGGATGAAATGTTTAATAATAAAATTACTTATAACTATAGT
    TCGCCAATTGCAGGAATTGATAAACCAAATGGCGCGAACATTTCTTCTCAAATTATTGGT
    GTAGATACAGCTTCAGGTCAAAACACATACAAGCAAACAGTATTTGTTAACCCTAAGCAA
    CGAGTTTTAGGTAATACGTGGGTGTATATTAAAGGCTACCAAGATAAAATCGAAGAAAGT
    AGCGGTAAAGTAAGTGCTACAGATACAAAACTGAGAATTTTTGAAGTGAATGATACATCT
    AAATTATCAGATAGCTACTATGCAGATCCAAATGACTCTAACCTTAAAGAAGTAACAGAC
    CAATTTAAAAATAGAATCTATTATGAGCATCCAAATGTAGCTAGTATTAAATTTGGTGAT
    ATTACTAAAACATATGTAGTATTAGTAGAAGGGCATTACGACAATACAGGTAAGAACTTA
    AAAACTCAGGTTATTCAAGAAAATGTTGATCCTGTAACAAATAGAGACTACAGTATTTTC
    GGTTGGAATAATGAGAATGTTGTACGTTATGGTGGTGGAAGTGCTGATGGTGATTCAGCA
    GTAAATCCGAAAGACCCAACTCCAGGGCCGCCGGTTGACCCAGAACCAAGTCCAGACCCA
    GAACCAGAACCAACGCCAGATCCAGAACCAAGTCCAGACCCAGAACCGGAACCAAGCCCA
    GACCCGGATCCGGATTCGGATTCAGACAGTGACTCAGGCTCAGACAGCGACTCAGGTTCA
    GATAGCGACTCAGAATCAGATAGCGATTCGGATTCAGACAGTGATTCAGATTCAGACAGC
    GACTCAGAATCAGATAGCGATTCAGAATCAGATAGCGACTCAGATTCAGATAGCGATTCA
    GATTCAGATAGCGATTCAGATTCAGATAGCGATTCGGATTCAGACAGTGATTCAGATTCA
    GACAGCGACTCAGAATCAGATAGCGACTCAGAATCAGATAGTGAGTCAGATTCAGACAGT
    GACTCGGACTCAGACAGTGATTCAGACTCAGATAGCGATTCAGACTCAGATAGCGATTCA
    GATTCAGACAGCGACTCAGATTCAGACAGCGACTCAGACTCAGATAGCGACTCAGACTCA
    GACAGCGACTCAGATTCAGATAGCGATTCAGACTCAGACAGCGACTCAGACTCAGACAGC
    GACTCAGACTCAGATAGCGACTCAGATTCAGATAGCGATTCAGACTCAGACAGCGACTCA
    GATTCAGATAGCGATTCGGACTCAGACAGCGATTCAGATTCAGACAGCGACTCAGACTCG
    GATAGCGATTCAGATTCAGATAGCGATTCGGATTCAGACAGTGATTCAGATTCAGACAGC
    GACTCAGACTCGGATAGCGACTCAGACTCAGACAGCGATTCAGACTCAGATAGCGACTCA
    GACTCGGATAGCGACTCGGATTCAGATAGCGACTCAGACTCAGATAGTGACTCCGATTCA
    AGAGTTACACCACCAAATAATGAACAGAAAGCACCATCAAATCCTAAAGGTGAAGTAAAC
    CATTCTAATAAGGTATCAAAACAACACAAAACTGATGCTTTACCAGAAACAGGAGATAAG
    AGCGAAAACACAAATGCAACTTTATTTGGTGCAATGATGGCATTATTAGGATCATTACTA
    TTGTTTAGAAAACGCAAGCAAGATCATAAAGAAAAAGCGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2460
    2520
    2580
    2640
    2700
    2742

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2652 [new locus tag: SACOL_RS13890 ]
  • symbol: ClfB
  • description: clumping factor B
  • length: 913
  • theoretical pI: 3.66716
  • theoretical MW: 97260.9
  • GRAVY: -1.20821

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    gram-positive signal peptide, YSIRK family (TIGR01168; HMM-score: 51.9)
    Cell structureCell envelopeOtherLPXTG cell wall anchor domain (TIGR01167; HMM-score: 28.6)
  • TheSEED:  
    Virulence, Disease and DefenseAdhesionAdhesins in Staphylococcus Clumping factor ClfB, fibrinogen binding protein 
  • PFAM:
    Adhesin (CL0204) SdrG_C_C; C-terminus of bacterial fibrinogen-binding adhesin (PF10425; HMM-score: 135.6)
    no clan definedYSIRK_signal; YSIRK type signal peptide (PF04650; HMM-score: 41.9)
    Gram_pos_anchor; LPXTG cell wall anchor motif (PF00746; HMM-score: 39.5)
    TonB_N; TonB N-terminal region (PF16031; HMM-score: 21)
    DUF1970; Domain of unknown function (DUF1970) (PF09301; HMM-score: 8.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cellwall
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 10
    • Extracellular Score: 0
    • Internal Helices: 2
  • LocateP: LPxTG Cell-wall anchored
    • Prediction by SwissProt Classification: Cell Wall
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: 0.5
    • N-terminally Anchored Score: 2
    • Predicted Cleavage Site: found LPxTG motif :LPETG
  • SignalP: Signal peptide length 45 aa
    • Ymax: 0.736
    • Ymax_pos: 45
    • Cmax: 0.747
    • Cmax_pos: 45
    • Smax: 0.904
    • Smax_pos: 41
    • Smean: 0.539
    • D: 0.659
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKKRIDYLSNKQNKYSIRRFTVGTTSVIVGATILFGIGNHQAQASEQSNDTTQSSKNNASADSEKNNMIETPQLNTTANDTSDISANTNSANVDSTTKPMSTQTSNTTTTEPASTNETPQPTAIKNQATAAKMQDQTVPQEANSQVDNKTTNDANSIATNSELKNSQTLDLPQSSPQTISNAQGTSKPSVRTRAVRSLAVAEPVVNAADAKGTNVNDKVTASNFKLEKTTFDPNQSGNTFMAANFTVTDKVKSGDYFTAKLPDSLTGNGDVDYSNSNNTMPIADIKSTNGDVVAKATYDILTKTYTFVFTDYVNNKENINGQFSLPLFTDRAKAPKSGTYDANINIADEMFNNKITYNYSSPIAGIDKPNGANISSQIIGVDTASGQNTYKQTVFVNPKQRVLGNTWVYIKGYQDKIEESSGKVSATDTKLRIFEVNDTSKLSDSYYADPNDSNLKEVTDQFKNRIYYEHPNVASIKFGDITKTYVVLVEGHYDNTGKNLKTQVIQENVDPVTNRDYSIFGWNNENVVRYGGGSADGDSAVNPKDPTPGPPVDPEPSPDPEPEPTPDPEPSPDPEPEPSPDPDPDSDSDSDSGSDSDSGSDSDSESDSDSDSDSDSDSDSDSESDSDSESDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSESDSDSESDSESDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSDSRVTPPNNEQKAPSNPKGEVNHSNKVSKQHKTDALPETGDKSENTNATLFGAMMALLGSLLLFRKRKQDHKEKA

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J. Proteome Res.: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  3. Annette Dreisbach, Kristina Hempel, Girbe Buist, Michael Hecker, Dörte Becher, Jan Maarten van Dijl
    Profiling the surfacome of Staphylococcus aureus.
    Proteomics: 2010, 10(17);3082-96
    [PubMed:20662103] [WorldCat.org] [DOI] (I p)
  4. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  5. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]

T J Foster, M Höök
Surface protein adhesins of Staphylococcus aureus.
Trends Microbiol.: 1998, 6(12);484-8
[PubMed:10036727] [WorldCat.org] (P p)