From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS00125 [old locus tag: SACOL0020 ]
  • pan locus tag?: SAUPAN000033000
  • symbol: SACOL_RS00125
  • pan gene symbol?: walK
  • synonym:
  • product: cell wall metabolism sensor histidine kinase WalK

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS00125 [old locus tag: SACOL0020 ]
  • symbol: SACOL_RS00125
  • product: cell wall metabolism sensor histidine kinase WalK
  • replicon: chromosome
  • strand: +
  • coordinates: 25666..27492
  • length: 1827
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (25666..27492) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    ATGAAGTGGCTAAAACAACTACAATCCCTTCATACTAAACTTGTAATTGTTTATGTATTA
    CTGATTATCATTGGTATGCAAATTATCGGGTTATATTTTACAAATAACCTTGAAAAAGAG
    CTGCTTGATAATTTTAAGAAGAATATTACGCAGTACGCGAAACAATTAGAAATTAGTATT
    GAAAAAGTATATGACGAAAAGGGCTCCGTAAATGCACAAAAAGATATTCAAAATTTATTA
    AGTGAGTATGCCAACCGTCAAGAAATTGGAGAAATTCGTTTTATAGATAAAGACCAAATT
    ATTATTGCGACGACGAAGCAGTCTAACCGTAGTCTAATCAATCAAAAAGCGAATGATAGT
    TCTGTCCAAAAAGCACTATCACTAGGACAATCAAACGATCATTTAATTTTAAAAGATTAT
    GGCGGTGGTAAGGACCGTGTCTGGGTATATAATATCCCAGTTAAAGTCGATAAAAAGGTA
    ATTGGTAATATTTATATCGAATCAAAAATTAATGACGTTTATAACCAATTAAATAATATA
    AATCAAATATTCATTGTTGGTACAGCTATTTCATTATTAATCACAGTCATCCTAGGATTC
    TTTATAGCGCGAACGATTACCAAACCAATCACCGATATGCGTAACCAGACGGTCGAAATG
    TCCAGAGGTAACTATACGCAACGTGTGAAGATTTATGGTAATGATGAAATTGGCGAATTA
    GCTTTAGCATTTAATAACTTGTCTAAACGTGTACAAGAAGCGCAGGCTAATACTGAAAGT
    GAGAAACGTAGACTGGACTCAGTTATCACCCATATGAGTGATGGTATTATTGCAACAGAC
    CGCCGTGGACGTATTCGTATCGTCAATGATATGGCACTCAAGATGCTTGGTATGGCGAAA
    GAAGACATCATCGGATATTACATGTTAAGTGTATTAAGTCTTGAAGATGAATTTAAACTG
    GAAGAAATTCAAGAGAATAATGATAGTTTCTTATTAGATTTAAATGAAGAAGAAGGTCTA
    ATCGCACGTGTTAACTTTAGTACGATTGTGCAGGAAACAGGATTTGTAACTGGTTATATC
    GCTGTGTTACATGACGTAACTGAACAACAACAAGTTGAACGTGAGCGTCGTGAATTTGTT
    GCCAATGTATCACATGAGTTACGTACACCTTTAACTTCTATGAATAGTTACATTGAAGCA
    CTTGAAGAAGGTGCATGGAAAGATGAGGAACTTGCGCCACAATTTTTATCTGTTACCCGT
    GAAGAAACAGAACGAATGATTCGACTGGTCAATGACTTGCTACAGTTATCTAAAATGGAT
    AATGAGTCTGATCAAATCAACAAAGAAATTATCGACTTTAACATGTTCATTAATAAAATT
    ATTAATCGACATGAAATGTCTGCGAAAGATACAACATTTATTCGAGATATTCCGAAAAAG
    ACGATTTTCACAGAATTTGATCCTGATAAAATGACGCAAGTATTTGATAATGTCATTACA
    AATGCGATGAAATATTCTAGAGGCGATAAACGTGTCGAGTTCCACGTGAAACAAAATCCA
    CTTTATAATCGAATGACGATTCGTATTAAAGATAATGGCATTGGTATTCCTATCAATAAA
    GTCGATAAGATATTCGACCGATTCTATCGTGTAGATAAGGCACGTACGCGTAAAATGGGT
    GGTACTGGATTAGGACTAGCCATTTCGAAAGAGATTGTGGAAGCGCACAATGGTCGTATT
    TGGGCAAACAGTGTAGAAGGTCAAGGTACATCTATCTTTATCACACTTCCATGTGAAGTC
    ATTGAAGACGGTGATTGGGATGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1827

Protein[edit source | edit]

Protein Data Bank: 5IS1

General[edit source | edit]

  • locus tag: SACOL_RS00125 [old locus tag: SACOL0020 ]
  • symbol: SACOL_RS00125
  • description: cell wall metabolism sensor histidine kinase WalK
  • length: 608
  • theoretical pI: 5.39883
  • theoretical MW: 69923.5
  • GRAVY: -0.353783

Function[edit source | edit]

  • reaction:
    EC 2.7.13.3?  ExPASy
    Histidine kinaseATP + protein L-histidine = ADP + protein N-phospho-L-histidine
  • TIGRFAM:
    Signal transductionSignal transductionTwo-component systemsphosphate regulon sensor kinase PhoR (TIGR02966; EC 2.7.3.-; HMM-score: 248)
    heavy metal sensor kinase (TIGR01386; EC 2.7.13.3; HMM-score: 183.8)
    Signal transductionSignal transductionTwo-component systemsTMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 126.8)
    proteobacterial dedicated sortase system histidine kinase (TIGR03785; HMM-score: 121)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingputative PEP-CTERM system histidine kinase (TIGR02916; EC 2.7.13.3; HMM-score: 55.5)
    Signal transductionSignal transductionTwo-component systemsputative PEP-CTERM system histidine kinase (TIGR02916; EC 2.7.13.3; HMM-score: 55.5)
    MetabolismCentral intermediary metabolismNitrogen fixationnitrogen fixation negative regulator NifL (TIGR02938; HMM-score: 44.5)
    Signal transductionRegulatory functionsProtein interactionsnitrogen fixation negative regulator NifL (TIGR02938; HMM-score: 44.5)
    Signal transductionRegulatory functionsSmall molecule interactionsPAS domain S-box protein (TIGR00229; HMM-score: 44.2)
    MetabolismEnergy metabolismPhotosynthesistranscriptional regulator PpsR (TIGR02040; HMM-score: 18.1)
    Signal transductionRegulatory functionsDNA interactionstranscriptional regulator PpsR (TIGR02040; HMM-score: 18.1)
    Cellular processesCellular processesSporulation and germinationsporulation lipoprotein, YhcN/YlaJ family (TIGR02898; HMM-score: 17.4)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA topoisomerase VI, B subunit (TIGR01052; EC 5.99.1.3; HMM-score: 16.5)
    VPDSG-CTERM protein sorting domain (TIGR03778; HMM-score: 11.3)
    CXXX repeat peptide modification system protein (TIGR04116; HMM-score: 4.5)
  • TheSEED:
  • PFAM:
    His_Kinase_A (CL0025) HATPase_c; Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase (PF02518; HMM-score: 92.8)
    HisKA; His Kinase A (phospho-acceptor) domain (PF00512; HMM-score: 69.8)
    no clan definedHAMP; HAMP domain (PF00672; HMM-score: 43.6)
    PAS_Fold (CL0183) PAS; PAS fold (PF00989; HMM-score: 34)
    PAS_9; PAS domain (PF13426; HMM-score: 33.2)
    PAS_8; PAS domain (PF13188; HMM-score: 28.9)
    Cache (CL0165) dCache_3; Double sensory domain of two-component sensor kinase (PF14827; HMM-score: 21.6)
    His_Kinase_A (CL0025) HATPase_c_3; Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase (PF13589; HMM-score: 21)
    PAS_Fold (CL0183) PAS_4; PAS fold (PF08448; HMM-score: 20.5)
    PAS_7; PAS fold (PF12860; HMM-score: 18.4)
    no clan definedSOTI; Male-specific protein scotti (PF17079; HMM-score: 14.6)
    OPA3; Optic atrophy 3 protein (OPA3) (PF07047; HMM-score: 12.8)
    Ntox50; Bacterial toxin 50 (PF15542; HMM-score: 11.7)
    UPF0154; Uncharacterised protein family (UPF0154) (PF03672; HMM-score: 11)
    DUF948; Bacterial protein of unknown function (DUF948) (PF06103; HMM-score: 7.3)
    P-loop_NTPase (CL0023) AAA_11; AAA domain (PF13086; HMM-score: 6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL_RS00120DNA-binding response regulator  [1] (data from MRSA252)
    SACOL_RS0650530S ribosomal protein S2  [1] (data from MRSA252)
    SACOL_RS1169530S ribosomal protein S5  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.17
    • Cytoplasmic Membrane Score: 9.51
    • Cellwall Score: 0.16
    • Extracellular Score: 0.15
    • Internal Helices: 2
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.147
    • Ymax_pos: 13
    • Cmax: 0.126
    • Cmax_pos: 32
    • Smax: 0.264
    • Smax_pos: 5
    • Smean: 0.208
    • D: 0.171
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit source | edit]

  • GI: 446794351 NCBI
  • RefSeq: WP_000871607 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKWLKQLQSLHTKLVIVYVLLIIIGMQIIGLYFTNNLEKELLDNFKKNITQYAKQLEISIEKVYDEKGSVNAQKDIQNLLSEYANRQEIGEIRFIDKDQIIIATTKQSNRSLINQKANDSSVQKALSLGQSNDHLILKDYGGGKDRVWVYNIPVKVDKKVIGNIYIESKINDVYNQLNNINQIFIVGTAISLLITVILGFFIARTITKPITDMRNQTVEMSRGNYTQRVKIYGNDEIGELALAFNNLSKRVQEAQANTESEKRRLDSVITHMSDGIIATDRRGRIRIVNDMALKMLGMAKEDIIGYYMLSVLSLEDEFKLEEIQENNDSFLLDLNEEEGLIARVNFSTIVQETGFVTGYIAVLHDVTEQQQVERERREFVANVSHELRTPLTSMNSYIEALEEGAWKDEELAPQFLSVTREETERMIRLVNDLLQLSKMDNESDQINKEIIDFNMFINKIINRHEMSAKDTTFIRDIPKKTIFTEFDPDKMTQVFDNVITNAMKYSRGDKRVEFHVKQNPLYNRMTIRIKDNGIGIPINKVDKIFDRFYRVDKARTRKMGGTGLGLAISKEIVEAHNGRIWANSVEGQGTSIFITLPCEVIEDGDWDE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS00125 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]