From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS02280 [old locus tag: SACOL0451 ]
  • pan locus tag?: SAUPAN001981000
  • symbol: SACOL_RS02280
  • pan gene symbol?: ahpF
  • synonym:
  • product: alkyl hydroperoxide reductase subunit F

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS02280 [old locus tag: SACOL0451 ]
  • symbol: SACOL_RS02280
  • product: alkyl hydroperoxide reductase subunit F
  • replicon: chromosome
  • strand: -
  • coordinates: 451793..453316
  • length: 1524
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (451793..453316) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    ATGCTTAATGCTGATTTAAAACAACAACTTAAACAACTATTAGAACTAATGGAGGGCAAC
    GTTGAATTCGTTGCCAGCCTTGGTTCAGATGATAAATCCAAAGAACTTAAAGATTTGTTG
    ACAGAAATTACTGATATGTCACCTAGACTATCTCTTTCTGAAAAATCTTTAAAACGTACA
    CCAAGTTTCTCAGTCAATCGTCCTGGCGAAGAAACAGGTGTAACATTTGCAGGTATTCCA
    TTAGGTCACGAGTTTAACTCACTTGTTTTAGCAATTTTACAGGTTAGTGGTCGTGCACCT
    AAAGAAAAACAGTCAATCATTGACCAAATTAAAAAATTAGAAGGTTCATTCCATTTTGAA
    ACATTCATTAGTTTAACGTGTCAAAAATGTCCTGATGTCGTTCAAGCACTTAACTTAATG
    AGTGTGATCAACCCTAACATCACGCATTCTATGATTGATGGTGCAGTGTTCCGTGAAGAA
    TCTGAAAACATCATGGCAGTCCCTGCTGTCTTTTTAAATGGCGAAGAATTTGGCAATGGT
    CGTATGACAATCCAAGATATTCTTTCGAAACTAGGCAGTACGGCAGATGCATCTGAGTTT
    GAAAATAAAGAACCTTATGATGTCTTAATCGTTGGTGGTGGTCCTGCTAGTGGTAGTGCA
    GCGATTTACACAGCACGTAAAGGTTTACGTACTGGTATAGTTGCTGATCGTATCGGTGGC
    CAAGTTAATGATACTGCTGGTATTGAGAACTTCATTACTGTTAAAGAAACAACTGGTTCT
    GAATTTTCTTCTAACTTAGCAGCGCACATTGATCAATATGACATTGATGCAATGACAGGT
    ATACGTGCTACAGATATCGAAAAGACTGACGAAGCAATTAAAGTTACGTTAGAAAACGGT
    GCTGTCTTAGAAAGTAAAACAGTCATTATTGCTACTGGTGCAGGTTGGCGTAAGCTAAAC
    ATTCCAGGTGAAGAGCAATTGATTAATAAAGGTGTTGCATTCTGCCCTCACTGTGACGGA
    CCTCTATTTGAAAATAAAGACGTAGCAGTTATCGGTGGCGGTAACTCTGGGGTTGAAGCA
    GCAATTGACCTTGCTGGTATCGTTAATCATGTTACATTATTCGAATTCGCTAGCGAATTA
    AAAGCAGACAACGTGTTACAAGATCGTTTACGTTCTTTATCAAATGTTGATATCAAAACA
    AATGCCAAAACTACTGAAGTTGTCGGAGAAGACCATGTTACAGGTATACGTTACGAAGAC
    ATGAACACCGGCGAAGAACATCTACTTAACTTAGATGGTATCTTTGTTCAAATTGGTTTA
    CTTCCAAACACATCATGGTTAAACGATGCTGTTGAATTAAACGAACGTGGTGAAATTGTG
    ATTGATCGTAACAATAATACGAATGTTCCTGGAATATTTGCTGCTGGCGATGTCACAGAT
    CAGAAGAACAAACAAATTATCATTTCAATGGGCGCTGGTGCAAATGCAGCATTAAATGCC
    TTTGACTATATTATCAGAAACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1524

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS02280 [old locus tag: SACOL0451 ]
  • symbol: SACOL_RS02280
  • description: alkyl hydroperoxide reductase subunit F
  • length: 507
  • theoretical pI: 4.41296
  • theoretical MW: 54720.4
  • GRAVY: -0.126627

Function[edit source | edit]

  • reaction:
    EC 1.8.1.-?  ExPASy
  • TIGRFAM:
    Cellular processesCellular processesDetoxificationalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 811.1)
    Cellular processesCellular processesAdaptations to atypical conditionsalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 811.1)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 307.4)
    MetabolismEnergy metabolismElectron transportthioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 277.9)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 78.7)
    glutaredoxin-like domain protein (TIGR02187; HMM-score: 74)
    Cellular processesCellular processesDetoxificationmercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 73.8)
    Unknown functionEnzymes of unknown specificityputative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 70.9)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 56.1)
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 51.4)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 50.7)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 46.5)
    MetabolismCentral intermediary metabolismNitrogen metabolismnitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 44)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 42.2)
    trypanothione-disulfide reductase (TIGR01423; EC 1.8.1.12; HMM-score: 40.8)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 35.3)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 33.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 31)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 30)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 29.7)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 28.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 25.5)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 25.4)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 23.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis enzyme (TIGR00292; HMM-score: 23.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 21)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 17.8)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 17.8)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 17.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 16.9)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA (TIGR00136; HMM-score: 15.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPyridine nucleotidesL-aspartate oxidase (TIGR00551; EC 1.4.3.16; HMM-score: 15.5)
    MetabolismEnergy metabolismTCA cyclesuccinate dehydrogenase, flavoprotein subunit (TIGR01816; HMM-score: 15.5)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 14.6)
    MetabolismEnergy metabolismElectron transportflavocytochrome c (TIGR01813; HMM-score: 14.3)
    MetabolismEnergy metabolismAnaerobicglycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 12.5)
    lycopene cyclase family protein (TIGR01790; HMM-score: 11.8)
    MetabolismEnergy metabolismTCA cyclesuccinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 11.7)
    MetabolismEnergy metabolismAnaerobicsuccinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 11.7)
    MetabolismEnergy metabolismAerobicsuccinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 11.7)
    salicylate 1-monooxygenase (TIGR03219; EC 1.14.13.1; HMM-score: 11.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase (TIGR02028; HMM-score: 11.1)
    MetabolismEnergy metabolismTCA cyclesuccinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01811; EC 1.3.99.1; HMM-score: 9.4)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 156)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 88.9)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 55.5)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 32.1)
    Thioredoxin (CL0172) Thioredoxin_3; Thioredoxin domain (PF13192; HMM-score: 29.7)
    NADP_Rossmann (CL0063) HI0933_like; HI0933-like protein (PF03486; HMM-score: 23.9)
    Thi4; Thi4 family (PF01946; HMM-score: 22.1)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 18.6)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 18.6)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 17.5)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 17.5)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 15.5)
    K_oxygenase; L-lysine 6-monooxygenase (NADPH-requiring) (PF13434; HMM-score: 14.8)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 14.5)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 13.5)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 13.3)
    Thioredoxin (CL0172) Glutaredoxin; Glutaredoxin (PF00462; HMM-score: 12.5)
    NADP_Rossmann (CL0063) Trp_halogenase; Tryptophan halogenase (PF04820; HMM-score: 12.3)
    Spermine_synth; Spermine/spermidine synthase domain (PF01564; HMM-score: 11.8)
    Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 11.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.131
    • Ymax_pos: 17
    • Cmax: 0.113
    • Cmax_pos: 25
    • Smax: 0.207
    • Smax_pos: 9
    • Smean: 0.167
    • D: 0.145
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446853230 NCBI
  • RefSeq: WP_000930486 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MLNADLKQQLKQLLELMEGNVEFVASLGSDDKSKELKDLLTEITDMSPRLSLSEKSLKRTPSFSVNRPGEETGVTFAGIPLGHEFNSLVLAILQVSGRAPKEKQSIIDQIKKLEGSFHFETFISLTCQKCPDVVQALNLMSVINPNITHSMIDGAVFREESENIMAVPAVFLNGEEFGNGRMTIQDILSKLGSTADASEFENKEPYDVLIVGGGPASGSAAIYTARKGLRTGIVADRIGGQVNDTAGIENFITVKETTGSEFSSNLAAHIDQYDIDAMTGIRATDIEKTDEAIKVTLENGAVLESKTVIIATGAGWRKLNIPGEEQLINKGVAFCPHCDGPLFENKDVAVIGGGNSGVEAAIDLAGIVNHVTLFEFASELKADNVLQDRLRSLSNVDIKTNAKTTEVVGEDHVTGIRYEDMNTGEEHLLNLDGIFVQIGLLPNTSWLNDAVELNERGEIVIDRNNNTNVPGIFAAGDVTDQKNKQIIISMGAGANAALNAFDYIIRN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS02280 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]