From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS03600 [old locus tag: SACOL0700 ]
  • pan locus tag?: SAUPAN002520000
  • symbol: SACOL_RS03600
  • pan gene symbol?: abcA
  • synonym:
  • product: ABC transporter ATP-binding protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS03600 [old locus tag: SACOL0700 ]
  • symbol: SACOL_RS03600
  • product: ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: +
  • coordinates: 724646..726373
  • length: 1728
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (724646..726373) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    ATGAAACGAGAAAATCCATTGTTTTTCTTATTTAAAAAACTATCATGGCCAGTGGGTCTT
    ATCGTTGCAGCTATCACTATTTCATCACTAGGGAGCTTAAGTGGACTATTAGTGCCACTG
    TTTACTGGACGAATTGTAGATAAATTTTCCGTGAGCCATATCAATTGGAATCTAATCGCA
    TTATTTGGTGGTATCTTTGTCATCAATGCTTTATTAAGCGGATTAGGTTTATATTTATTA
    AGTAAAATTGGTGAAAAGATTATTTATGCGATACGCTCAGTTTTATGGGAGCATATCATA
    CAATTAAAAATGCCATTCTTTGACAAAAATGAAAGTGGTCAATTAATGAGTCGATTAACT
    GACGATACGAAAGTGATAAATGAATTTATTTCACAAAAGCTACCTAACTTATTACCATCA
    ATCGTTACATTAGTTGGGTCACTAATCATGTTATTTATTTTAGATTGGAAAATGACATTA
    TTAACATTTATAACGATACCGATATTCGTTTTAATTATGATTCCTCTAGGTCGTATTATG
    CAAAAGATATCGACAAGTACACAATCTGAAATTGCAAACTTCAGTGGTTTGTTAGGGCGT
    GTCCTAACTGAAATGCGTCTTGTTAAAATATCAAATACAGAGCGTCTTGAATTAGATAAT
    GCACATAAAAATTTGAATGAAATATATAAATTAGGTTTAAAACAGGCTAAAATTGCGGCA
    GTTGTACAACCAATTTCAGGTATAGTTATGTTGCTAACAATTGCAATTATTTTAGGTTTT
    GGTGCATTAGAAATTGCGACTGGTGCAATCACTGCAGGTACATTAATTGCAATGATATTT
    TATGTTATTCAGTTATCTATGCCTTTAATCAATCTTTCCACGTTAGTTACAGATTATAAA
    AAGGCAGTCGGTGCAAGTAGTAGAATATACGAAATCATGCAAGAACCTATTGAACCGACA
    GAAGCTCTTGAAGATTCTGAAAATGTATTAATTGATGACGGTGTATTGTCATTTGAACAT
    GTAGACTTTAAATATGATGTGAAGAAAATATTAGATGATGTGTCGTTCCAAATCCCACAA
    GGTCAAGTGAGTGCTTTTGTAGGCCCTTCTGGGTCTGGTAAAAGTACGATATTTAATCTG
    ATAGAACGTATGTATGAAATTGAGTCAGGTGATATTAAATATGGCCTTGAAAGTGTCTAT
    GATATCCCGTTATCTAAGTGGCGACGCAAAATTGGATATGTTATGCAATCAAATTCGATG
    ATGAGTGGTACAATTAGAGACAATATTTTATACGGAATTAATCGTCATGTTTCAGATGAA
    GAACTTATTAATTATGCTAAATTAGCGAACTGTCATGATTTTATCATGCAATTTGATGAA
    GGATATGACACGCTTGTAGGTGAACGAGGATTGAAACTGTCTGGCGGACAACGTCAACGT
    ATTGATATTGCTAGAAGTTTTGTTAAAAATCCTGATATTTTGTTACTTGATGAAGCAACA
    GCTAATCTCGATAGTGAAAGTGAATTGAAAATTCAAGAAGCTTTAGAAACATTGATGGAA
    GGTAGAACAACGATTGTCATTGCGCATCGTTTGTCTACAATTAAAAAAGCCGGTCAAATT
    ATATTCTTAGACAAAGGACAGGTAACAGGTAAAGGTACGCATTCAGAACTGATGGCATCA
    CATGCGAAGTATAAAAACTTTGTAGTGTCTCAAAAATTAACAGATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1728

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS03600 [old locus tag: SACOL0700 ]
  • symbol: SACOL_RS03600
  • description: ABC transporter ATP-binding protein
  • length: 575
  • theoretical pI: 6.81187
  • theoretical MW: 64050.6
  • GRAVY: 0.255478

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 447.1)
    MetabolismTransport and binding proteinsOtherantigen peptide transporter 2 (TIGR00958; HMM-score: 413.7)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharideslipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 405.2)
    MetabolismTransport and binding proteinsOtherlipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 405.2)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01846; HMM-score: 344.1)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 313.7)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 313.7)
    Cellular processesCellular processesPathogenesistype I secretion system ATPase (TIGR03375; HMM-score: 298.8)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR03375; HMM-score: 298.8)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 290.3)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 290.3)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingABC-type bacteriocin transporter (TIGR01193; HMM-score: 266.9)
    Genetic information processingProtein fateProtein modification and repairABC-type bacteriocin transporter (TIGR01193; HMM-score: 266.9)
    MetabolismTransport and binding proteinsOtherABC-type bacteriocin transporter (TIGR01193; HMM-score: 266.9)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 265)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsglucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 230)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01842; HMM-score: 213.2)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 206.2)
    MetabolismTransport and binding proteinsAnionsphosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 136)
    MetabolismTransport and binding proteinsOthermulti drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 134.2)
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 125.9)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 123.6)
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 116.2)
    MetabolismTransport and binding proteinsAnionscystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 113.5)
    MetabolismTransport and binding proteinsAnionsphosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 112.4)
    Cellular processesCellular processesToxin production and resistanceputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 111.1)
    MetabolismTransport and binding proteinsUnknown substrateputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 111.1)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 108)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesglycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 105.1)
    Cellular processesCellular processesCell divisioncell division ATP-binding protein FtsE (TIGR02673; HMM-score: 105.1)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 103.8)
    MetabolismTransport and binding proteinsOtherLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 103.8)
    MetabolismTransport and binding proteinsAnionsmolybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 103.6)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 103.6)
    MetabolismTransport and binding proteinsAnionssulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 102)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesputative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 96.8)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 96.6)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminespolyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 91.1)
    MetabolismTransport and binding proteinsOtherdaunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 90)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 86.9)
    Genetic information processingProtein fateProtein and peptide secretion and traffickinglipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 84.2)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 83.5)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 82.9)
    MetabolismTransport and binding proteinsCations and iron carrying compoundscobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 82.7)
    MetabolismTransport and binding proteinsOtherpigment precursor permease (TIGR00955; HMM-score: 82.5)
    MetabolismTransport and binding proteinsOtherthiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 80.1)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 79.8)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 79.7)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 79.6)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 77.8)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminescyclic peptide transporter (TIGR01194; HMM-score: 77.3)
    MetabolismTransport and binding proteinsOthercyclic peptide transporter (TIGR01194; HMM-score: 77.3)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsperoxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 73)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherFeS assembly ATPase SufC (TIGR01978; HMM-score: 69.6)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 68)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel import ATP-binding protein NikD (TIGR02770; HMM-score: 66.1)
    Cellular processesCellular processesOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 64.2)
    MetabolismTransport and binding proteinsOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 64.2)
    MetabolismTransport and binding proteinsUnknown substrateanchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 64)
    MetabolismTransport and binding proteinsOtherpleiotropic drug resistance family protein (TIGR00956; HMM-score: 63.2)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 61.9)
    MetabolismEnergy metabolismMethanogenesismethyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 60.2)
    MetabolismTransport and binding proteinsAnionsnitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 58.5)
    MetabolismTransport and binding proteinsOthernitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 58.5)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminescholine ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 56)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 55.2)
    MetabolismTransport and binding proteinsOtherheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 55.2)
    MetabolismCentral intermediary metabolismPhosphorus compoundsphosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 52.1)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsD-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 42.3)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairexcinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 41.2)
    MetabolismTransport and binding proteinsOtherrim ABC transporter (TIGR01257; HMM-score: 36.4)
    Genetic information processingProtein synthesisTranslation factorsribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 16.1)
    Cellular processesCellular processesCell divisionchromosome segregation protein SMC (TIGR02168; HMM-score: 12.1)
    Genetic information processingDNA metabolismChromosome-associated proteinschromosome segregation protein SMC (TIGR02168; HMM-score: 12.1)
  • TheSEED:
  • PFAM:
    ABC_membrane (CL0241) ABC_membrane; ABC transporter transmembrane region (PF00664; HMM-score: 172)
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 113.1)
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 27.9)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 23.1)
    ABC_membrane (CL0241) ABC_membrane_3; ABC transporter transmembrane region (PF13748; HMM-score: 20)
    P-loop_NTPase (CL0023) AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 19.8)
    AAA_23; AAA domain (PF13476; HMM-score: 17)
    AAA_22; AAA domain (PF13401; HMM-score: 16.6)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 15.3)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 14.8)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 13.8)
    AAA_30; AAA domain (PF13604; HMM-score: 13.7)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 13.1)
    AAA_18; AAA domain (PF13238; HMM-score: 13.1)
    SbcCD_C; Putative exonuclease SbcCD, C subunit (PF13558; HMM-score: 11.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL_RS04310aldehyde dehydrogenase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 6
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.205
    • Ymax_pos: 25
    • Cmax: 0.139
    • Cmax_pos: 25
    • Smax: 0.471
    • Smax_pos: 3
    • Smean: 0.356
    • D: 0.264
  • predicted transmembrane helices (TMHMM): 6

Accession numbers[edit source | edit]

  • GI: 446740698 NCBI
  • RefSeq: WP_000817954 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKRENPLFFLFKKLSWPVGLIVAAITISSLGSLSGLLVPLFTGRIVDKFSVSHINWNLIALFGGIFVINALLSGLGLYLLSKIGEKIIYAIRSVLWEHIIQLKMPFFDKNESGQLMSRLTDDTKVINEFISQKLPNLLPSIVTLVGSLIMLFILDWKMTLLTFITIPIFVLIMIPLGRIMQKISTSTQSEIANFSGLLGRVLTEMRLVKISNTERLELDNAHKNLNEIYKLGLKQAKIAAVVQPISGIVMLLTIAIILGFGALEIATGAITAGTLIAMIFYVIQLSMPLINLSTLVTDYKKAVGASSRIYEIMQEPIEPTEALEDSENVLIDDGVLSFEHVDFKYDVKKILDDVSFQIPQGQVSAFVGPSGSGKSTIFNLIERMYEIESGDIKYGLESVYDIPLSKWRRKIGYVMQSNSMMSGTIRDNILYGINRHVSDEELINYAKLANCHDFIMQFDEGYDTLVGERGLKLSGGQRQRIDIARSFVKNPDILLLDEATANLDSESELKIQEALETLMEGRTTIVIAHRLSTIKKAGQIIFLDKGQVTGKGTHSELMASHAKYKNFVVSQKLTD

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS03600 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]