From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS03615 [old locus tag: SACOL0703 ]
  • pan locus tag?: SAUPAN002524000
  • symbol: SACOL_RS03615
  • pan gene symbol?:
  • synonym:
  • product: YitT family protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS03615 [old locus tag: SACOL0703 ]
  • symbol: SACOL_RS03615
  • product: YitT family protein
  • replicon: chromosome
  • strand: +
  • coordinates: 728486..729319
  • length: 834
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (728486..729319) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    GTGAATAAAACGGTTAAAGATTTAATACTAGTTGTCTTAGGTTCATTTATCTTTGCTGCA
    GGTGTAAATGCATTTATTATTTCTGGTAACTTAGGTGAAGGCGGGGTTACAGGTTTAGCA
    ATTATTTTATATTATGCGTTTCATATTTCACCAGCCATCACTAACTTCTTGGTCAACGCA
    GTATTGATTGCCATAGGTTATAAATTTTTGAGTAAGAGAAGTATGTACTTAACTATTCTT
    GTAACAATTCTTATTTCAATATTTTTGAGTTTAACAGAATCATGGCAAGTAGAAACTGGA
    AACAGCATTGTGAATGCCATTTTTGGTGGTGTAAGCGTTGGACTAGGAATCGGAGTAATT
    ATCCTTGCAGGCGGTACAACAGCAGGTACAACAATTTTGGCGAGAATTGCAACGAAATAC
    CTCGATGTAAGCACGCCATATGCTTTGCTTTTCTTCGATATGATCGTTGTTGCAATTTCA
    CTTACAGTTATTCCACTTGATAAAGTATTAGTAACAGTAATATCACTTTATATAGGAACA
    AAAGTGATGGAATATGTCATAGAAGGTTTAAACACTAAAAAAGCTATGACGATTATTTCA
    ACTAATCCCGACAAACTTGCCAAAGCAATAGACGAGCAAATTGGAAGAGGTTTAACCATT
    TTAAACGGACATGGCTATTATACGCGTGAAGAAAAAGATGTCTTATACGTTGTTATTTCT
    AAAACACAAGTTTCAAAAGCAAAGCGATTAATTAAACAAATCGATAAAGATGCATTCCTC
    GTAATTCATGATGTAAGAGATGTCTATGGTAATGGCTTTCTTGCAGATGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    834

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS03615 [old locus tag: SACOL0703 ]
  • symbol: SACOL_RS03615
  • description: YitT family protein
  • length: 277
  • theoretical pI: 9.04665
  • theoretical MW: 29917.1
  • GRAVY: 0.708664

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:
  • PFAM:
    no clan definedYitT_membrane; Uncharacterised 5xTM membrane BCR, YitT family COG1284 (PF02588; HMM-score: 198.6)
    GlnB-like (CL0089) DUF2179; Uncharacterized protein conserved in bacteria (DUF2179) (PF10035; HMM-score: 77.3)
    no clan definedODV-E18; Occlusion-derived virus envelope protein ODV-E18 (PF10717; HMM-score: 6.7)
    DUF2070; Predicted membrane protein (DUF2070) (PF09843; HMM-score: 5.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 5
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.261
    • Ymax_pos: 25
    • Cmax: 0.198
    • Cmax_pos: 25
    • Smax: 0.471
    • Smax_pos: 18
    • Smean: 0.361
    • D: 0.3
  • predicted transmembrane helices (TMHMM): 5

Accession numbers[edit source | edit]

  • GI: 446967406 NCBI
  • RefSeq: WP_001044662 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MNKTVKDLILVVLGSFIFAAGVNAFIISGNLGEGGVTGLAIILYYAFHISPAITNFLVNAVLIAIGYKFLSKRSMYLTILVTILISIFLSLTESWQVETGNSIVNAIFGGVSVGLGIGVIILAGGTTAGTTILARIATKYLDVSTPYALLFFDMIVVAISLTVIPLDKVLVTVISLYIGTKVMEYVIEGLNTKKAMTIISTNPDKLAKAIDEQIGRGLTILNGHGYYTREEKDVLYVVISKTQVSKAKRLIKQIDKDAFLVIHDVRDVYGNGFLADE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS03615 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]