From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS04010 [old locus tag: SACOL0779 ]
  • pan locus tag?: SAUPAN002607000
  • symbol: SACOL_RS04010
  • pan gene symbol?:
  • synonym:
  • product: ABC transporter ATP-binding protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS04010 [old locus tag: SACOL0779 ]
  • symbol: SACOL_RS04010
  • product: ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: +
  • coordinates: 800901..802784
  • length: 1884
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (800901..802784) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    ATGGGTATGGAAGCATATAAAATTGAACATTTAAATAAATCTTATGCCGATAAGACTATA
    TTCGATAACCTAGATTTATCAATTTCAGAAGGTGAAAAAATAGGTTTAGTAGGCATAAAT
    GGTACAGGGAAAAGTACGTTGTTAAAAGTAATTGGTGGTATTGATGATGATTTTACAGCC
    AATGTTATGCATCCAAATCAATATCGAATTCGATATTCGTCTCAGAAACAGGACCTTAAT
    GAAGATATGACAGTTTTTGATGCAGTATTAAGTTCTGATACAACAACTTTACGCATCATC
    AAGCAATATGAGCAGGCAGTACAAGCTTATGCGGATGACCAAAGTGATAAATTGTTCAAG
    CGAATGATGGATGCGCAAGATGCTATGGATCAACATGATGCTTGGGACTATAACGCTGAA
    ATTAAAACAATCCTCTCAAAACTAGGTATACATGATACTACTAAATACATTAAAGAATTA
    TCCGGCGGACAACAAAAACGTGTTGTACTTGCTAAAACATTAATAGAACAACCAGATTTA
    TTGTTATTAGATGAACCTACGAACCATTTAGACTTCGAATCAATCAGCTGGTTGATCAAT
    TATGTGAAGCAATATCCTCATACTGTTTTATTCGTAACCCATGATCGATATTTTTTAAAT
    GAAGTTTCCACTAGAATTATTGAACTAAACAGAGGTAAGTTAGCGTCATATCCTGGTAAC
    TATGAATCTTATATTGAAATGCGCGCTGAAAGAGAAGTAACACTTCAAAAGCAACAACAA
    AAGCAACGAGCTTTATATAAGGAAGAACTTGCTTGGATGAGGGCTGGAGCTAAGGCTCGT
    ACTACAAAGCAACAAGCTAGAATTAATCGATTTAATGACCTAGAAAATGAAGTTAACCAG
    CAATATAAAGACGATAAAGGTGAATTGAATCTTGCTTATTCAAGATTAGGTAAGCAAGTG
    TTCGAATTAGAAGACTTATCAAAGGCTATTAATGATAAAGTATTATTTGAACATCTGACG
    GAAATTATTCAAAAAGGTGAGCGTATTGGTGTTGTTGGGCCAAATGGAGCTGGTAAAACA
    ACACTCTTAAATATTTTGAGTGGAGAAGACCAACAATTCGAAGGTAAATTGAAGACTGGG
    CAGACGGTTAAAGTAGCTTATTTTAAGCAAACAGATGAGACCCTGGATAGAGATATTCGT
    ATGATTGATTATTTAAGAGAAGAAAATGAGATCGCAAAAGAAAAAGATGGAACCTCGGTA
    TCTATTACACAACTTCTTGAACGATTTTTATTTCCAAGTGCAACTCATGGTAAAAAAGTT
    TATAAATTATCTGGTGGAGAGCAAAAGCGTTTGTATTTATTACGTCTACTCGTACACCAG
    CCAAATGTTCTGTTGTTAGATGAACCGACAAATGATTTAGATACTGAGACTTTAACAATA
    CTTGAAGATTATATTCATACTTTCGGTGGTACAGTGATTACCGTAAGCCATGATCGCTAC
    TTCTTAAATAAAGTTGCACAGTCATATTGGTTTATTCATGATGGTCAGATGGAAAAGATT
    ATCGGAACTTTTGAAGATTATGAAAGTTATAAAAAATCATTAGATAAAAATAAATCCACA
    TTGAAGCAACAATCTAAATCTTCTACAACTGTACGTAAGAAAAATGGTTTATCATATAAA
    GAAAAATTAGAATATGAACAATTGATGAAACGCATAGAACAAGCGGAAGTAAGAATGGAA
    GAAATTGATGTGCTCATGATTGAGGCAAGTGCAGATTATGGGAAAATTAAAGAATTAAAC
    GAAGAAAAAGAACAACTTGAAATTCAATATGATTTAGACATCACAAGATGGAGTGAGTTA
    GAAGAAATTAAAGAACAACAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1884

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS04010 [old locus tag: SACOL0779 ]
  • symbol: SACOL_RS04010
  • description: ABC transporter ATP-binding protein
  • length: 627
  • theoretical pI: 5.1352
  • theoretical MW: 72624.6
  • GRAVY: -0.660128

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 494.4)
    Cellular processesCellular processesToxin production and resistanceputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 185.4)
    MetabolismTransport and binding proteinsUnknown substrateputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 185.4)
    Cellular processesCellular processesCell divisioncell division ATP-binding protein FtsE (TIGR02673; HMM-score: 158.5)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesputative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 158.1)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 157.3)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 156.8)
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 154.4)
    MetabolismTransport and binding proteinsOtherdaunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 152.9)
    Genetic information processingProtein fateProtein and peptide secretion and traffickinglipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 152.8)
    MetabolismTransport and binding proteinsAnionsphosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 150.9)
    Cellular processesCellular processesPathogenesistype I secretion system ATPase (TIGR03375; HMM-score: 150.3)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR03375; HMM-score: 150.3)
    MetabolismTransport and binding proteinsAnionssulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 146.7)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 146.7)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 146.4)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 145.6)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 141.7)
    MetabolismTransport and binding proteinsOtherheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 141.7)
    MetabolismTransport and binding proteinsAnionsphosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 140.1)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 135.1)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 130.4)
    MetabolismTransport and binding proteinsCations and iron carrying compoundscobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 129.8)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 129.3)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 129.2)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 127.6)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 127.6)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 127.3)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 124.9)
    MetabolismTransport and binding proteinsOtherLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 124.9)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 124.4)
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 122.4)
    MetabolismTransport and binding proteinsOtherthiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 121.4)
    MetabolismEnergy metabolismMethanogenesismethyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 121)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 117.8)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 117.8)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01842; HMM-score: 117.3)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 117.3)
    MetabolismTransport and binding proteinsUnknown substrateanchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 117.1)
    Cellular processesCellular processesOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 116.2)
    MetabolismTransport and binding proteinsOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 116.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherFeS assembly ATPase SufC (TIGR01978; HMM-score: 113.5)
    MetabolismTransport and binding proteinsAnionsmolybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 112.4)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminespolyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 112)
    MetabolismTransport and binding proteinsOtherantigen peptide transporter 2 (TIGR00958; HMM-score: 108.4)
    MetabolismTransport and binding proteinsAnionsnitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 105.9)
    MetabolismTransport and binding proteinsOthernitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 105.9)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01846; HMM-score: 105.9)
    MetabolismTransport and binding proteinsOtherpigment precursor permease (TIGR00955; HMM-score: 104)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsD-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 103.4)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 97.9)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 94)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesglycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 93.2)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingABC-type bacteriocin transporter (TIGR01193; HMM-score: 92.2)
    Genetic information processingProtein fateProtein modification and repairABC-type bacteriocin transporter (TIGR01193; HMM-score: 92.2)
    MetabolismTransport and binding proteinsOtherABC-type bacteriocin transporter (TIGR01193; HMM-score: 92.2)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsperoxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 90.2)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel import ATP-binding protein NikD (TIGR02770; HMM-score: 89.1)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminescholine ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 86.6)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 82.7)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharideslipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 80.1)
    MetabolismTransport and binding proteinsOtherlipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 80.1)
    MetabolismCentral intermediary metabolismPhosphorus compoundsphosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 76.8)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsglucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 62.7)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminescyclic peptide transporter (TIGR01194; HMM-score: 61.2)
    MetabolismTransport and binding proteinsOthercyclic peptide transporter (TIGR01194; HMM-score: 61.2)
    MetabolismTransport and binding proteinsAnionscystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 59.5)
    MetabolismTransport and binding proteinsOtherpleiotropic drug resistance family protein (TIGR00956; HMM-score: 56.3)
    MetabolismTransport and binding proteinsOthermulti drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 56.2)
    MetabolismTransport and binding proteinsOtherrim ABC transporter (TIGR01257; HMM-score: 38.4)
    Unknown functionGeneralsmall GTP-binding protein domain (TIGR00231; HMM-score: 25.1)
    Cellular processesCellular processesPathogenesistype III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 20.9)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 20.9)
    P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 20.9)
    Genetic information processingProtein synthesisOtherGTP-binding protein Era (TIGR00436; HMM-score: 20.6)
    Cellular processesCellular processesChemotaxis and motilityflagellar protein export ATPase FliI (TIGR03496; EC 3.6.3.14; HMM-score: 17.7)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesLAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 17)
    Signal transductionRegulatory functionsProtein interactionsLAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 17)
    Cellular processesCellular processesChemotaxis and motilityflagellar protein export ATPase FliI (TIGR03497; EC 3.6.3.14; HMM-score: 16.8)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 16.3)
    MetabolismCentral intermediary metabolismNitrogen metabolismurease accessory protein UreG (TIGR00101; HMM-score: 15.6)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingsignal recognition particle-docking protein FtsY (TIGR00064; HMM-score: 15.5)
    helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 15.3)
    MetabolismEnergy metabolismAmino acids and aminesethanolamine utilization protein, EutP (TIGR02528; HMM-score: 15.1)
    flagellar protein export ATPase FliI (TIGR03498; EC 3.6.3.14; HMM-score: 15.1)
    MetabolismEnergy metabolismATP-proton motive force interconversionATPase, FliI/YscN family (TIGR01026; EC 3.6.3.14; HMM-score: 13.8)
    MetabolismCentral intermediary metabolismPhosphorus compoundsphosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 13.1)
    Cellular processesCellular processesConjugationP-type conjugative transfer ATPase TrbB (TIGR02782; HMM-score: 11.7)
    Genetic information processingProtein synthesisOtherObg family GTPase CgtA (TIGR02729; HMM-score: 11)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionsguanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 10)
    Genetic information processingProtein synthesisOtherribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 9.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPantothenate and coenzyme Adephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 4.3)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 170.1)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 70)
    ABC_tran_Xtn; ABC transporter (PF12848; HMM-score: 43.3)
    no clan definedABC_tran_CTD; ABC transporter C-terminal domain (PF16326; HMM-score: 43.3)
    P-loop_NTPase (CL0023) SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 40.8)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 30.9)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 29.1)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 28.7)
    AAA_18; AAA domain (PF13238; HMM-score: 28.3)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 25.4)
    AAA_30; AAA domain (PF13604; HMM-score: 22.6)
    AAA_22; AAA domain (PF13401; HMM-score: 22.3)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 22.2)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 22.2)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 21.8)
    ArgK; ArgK protein (PF03308; HMM-score: 19.8)
    AAA_28; AAA domain (PF13521; HMM-score: 19.8)
    SbcCD_C; Putative exonuclease SbcCD, C subunit (PF13558; HMM-score: 18.8)
    no clan definedBacillus_HBL; Bacillus haemolytic enterotoxin (HBL) (PF05791; HMM-score: 18.6)
    P-loop_NTPase (CL0023) Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 18.5)
    Arf; ADP-ribosylation factor family (PF00025; HMM-score: 18.1)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 17.8)
    AAA_24; AAA domain (PF13479; HMM-score: 17.2)
    AAA_33; AAA domain (PF13671; HMM-score: 16.4)
    AAA_25; AAA domain (PF13481; HMM-score: 15.3)
    FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 14.4)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 14)
    NACHT; NACHT domain (PF05729; HMM-score: 13.9)
    ATP-synt_ab; ATP synthase alpha/beta family, nucleotide-binding domain (PF00006; HMM-score: 13.5)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 13.4)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 12)
    PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 11.3)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 10.1)
    SRP54; SRP54-type protein, GTPase domain (PF00448; HMM-score: 7.3)
    MobB; Molybdopterin guanine dinucleotide synthesis protein B (PF03205; HMM-score: 6.9)
    AAA_27; AAA domain (PF13514; HMM-score: 5.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL_RS03080elongation factor Tu  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.95
    • Cytoplasmic Membrane Score: 0.05
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.118
    • Ymax_pos: 54
    • Cmax: 0.173
    • Cmax_pos: 17
    • Smax: 0.196
    • Smax_pos: 52
    • Smean: 0.092
    • D: 0.108
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI:
  • RefSeq: WP_000525109 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MGMEAYKIEHLNKSYADKTIFDNLDLSISEGEKIGLVGINGTGKSTLLKVIGGIDDDFTANVMHPNQYRIRYSSQKQDLNEDMTVFDAVLSSDTTTLRIIKQYEQAVQAYADDQSDKLFKRMMDAQDAMDQHDAWDYNAEIKTILSKLGIHDTTKYIKELSGGQQKRVVLAKTLIEQPDLLLLDEPTNHLDFESISWLINYVKQYPHTVLFVTHDRYFLNEVSTRIIELNRGKLASYPGNYESYIEMRAEREVTLQKQQQKQRALYKEELAWMRAGAKARTTKQQARINRFNDLENEVNQQYKDDKGELNLAYSRLGKQVFELEDLSKAINDKVLFEHLTEIIQKGERIGVVGPNGAGKTTLLNILSGEDQQFEGKLKTGQTVKVAYFKQTDETLDRDIRMIDYLREENEIAKEKDGTSVSITQLLERFLFPSATHGKKVYKLSGGEQKRLYLLRLLVHQPNVLLLDEPTNDLDTETLTILEDYIHTFGGTVITVSHDRYFLNKVAQSYWFIHDGQMEKIIGTFEDYESYKKSLDKNKSTLKQQSKSSTTVRKKNGLSYKEKLEYEQLMKRIEQAEVRMEEIDVLMIEASADYGKIKELNEEKEQLEIQYDLDITRWSELEEIKEQQ

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS04010 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]