From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS05535 [old locus tag: SACOL1085 ]
  • pan locus tag?: SAUPAN003291000
  • symbol: SACOL_RS05535
  • pan gene symbol?: thiW
  • synonym:
  • product: ABC transporter ATP-binding protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS05535 [old locus tag: SACOL1085 ]
  • symbol: SACOL_RS05535
  • product: ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1095220..1096620
  • length: 1401
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (1095220..1096620) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    GTGTTAAAAGTAAGTGATTTACGATTAAAATATCCAAGTGGTCAACGTAAAATTTTCGAT
    CATTTAAATATCACTATTCAAGACAAAGAAAAAGTACTTTTACTCGGTCCTTCTGGTTGC
    GGTAAAAGTACACTTCTGAATGTATTAAGTGGTATTGTTCCTAATTTAATTGAATTACCT
    ATGAAATATGATGAACTAATCGTTGACCCATTAAGTGGCGTTATTTTCCAAGACCCTGAT
    AGCCAGTTTTGTATGCCAAAAGTATACGAAGAACTTGCATTCGTTTTAGAAAATAGACAA
    TTACCACGTGAAGACATGGATGCGTTAATTATCAATGCTTTAAATATGGTCAATTTAAAT
    GTTACCCCTGAAACGTATATCAAAGATTTAAGTGGCGGGATGAAACAGAAATTGGCAATT
    GTTGAAACCATTCTTCAACAATCAAAAACATTGTTTTTAGATGAACCGACAGCAATGTTA
    GATGTTCAAGCAACAGAAGATTTATGGACTAAACTAATTGAACTTTGGGAAGATCAAACG
    GTTGTAATCGTTGAACATAAAGTTAAACACATCTGGAATCATGTCGACCGCGTCATTTTG
    ATGGATTATAACGGAAATATCATTGCCGATGAATGTCCTGAAATCATATTACAGAAGTAT
    GTTCATTTACTCAGTGAATATGGTGTGTGGCATCCACGTGCATGGGAATTCGCACCAAGT
    CGTGTTGACTTTCCAACAACAAACTCACACTTATTACAATTTAAAAATGGACGTATTATT
    CGCGGTAAATCAACATTGCTCTCATTCTCAGATTTAGAAATTGGTCTAGGTGAGTGGATT
    ACAATTACAGGGGCAAATGGTAGTGGTAAAACAACCTTGCTTGAATCAATTATGCAATTG
    ATTAAATATCAAGGTGATGTTTATTTTGAAAATCAGCGTTTAACAAAAATTAAACATGCA
    GCAAAACACATGTACCTAGTTTATCAAAACCCAGAATTACAATTTATAACAAATTCGGTT
    TATGATGAAATTAACATTCATTTTAATCACCTTTCTAAAGATCAAAGTGATGATGAAACG
    ATACAACTTTTAAAACTTTTAGATTTACAAAATGTAAAAGATCAACATCCTTATGAGTTG
    TCTATTGGTCAAAAACGACGCCTTAGCGTAGCTACCGCACTAAGTTCTAAAGCTGATATT
    ATCTTTTTAGATGAACCGACATTTGGACTTGATAGCCATAATACATTCCAGTTGATCAAA
    CTTTTCCAAAAGCGAATTAATTTGGGACAAAGTATTGTCATGGTTACACATGACGATGAA
    ATAATTGAACGTTATCCATCAAGAAGACTTAAAATTTCAGATGGTGCGTTACTAGATTGT
    GATGGTGATACGAATGTATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1401

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS05535 [old locus tag: SACOL1085 ]
  • symbol: SACOL_RS05535
  • description: ABC transporter ATP-binding protein
  • length: 466
  • theoretical pI: 5.21638
  • theoretical MW: 53316
  • GRAVY: -0.181974

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 245.5)
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 230)
    Cellular processesCellular processesToxin production and resistanceputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 203.9)
    MetabolismTransport and binding proteinsUnknown substrateputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 203.9)
    MetabolismTransport and binding proteinsCations and iron carrying compoundscobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 192.6)
    Cellular processesCellular processesCell divisioncell division ATP-binding protein FtsE (TIGR02673; HMM-score: 179.2)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 175.7)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 171.2)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesputative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 169.7)
    Cellular processesCellular processesPathogenesistype I secretion system ATPase (TIGR03375; HMM-score: 164.6)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR03375; HMM-score: 164.6)
    MetabolismTransport and binding proteinsAnionsnitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 162.9)
    MetabolismTransport and binding proteinsOthernitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 162.9)
    MetabolismTransport and binding proteinsAnionsphosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 161.4)
    MetabolismTransport and binding proteinsAnionssulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 161.3)
    MetabolismTransport and binding proteinsAnionsphosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 160.7)
    MetabolismTransport and binding proteinsOtherdaunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 159.8)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminespolyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 152.8)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 152.8)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 152.5)
    MetabolismTransport and binding proteinsOtherheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 152.5)
    Genetic information processingProtein fateProtein and peptide secretion and traffickinglipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 151.3)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 150.6)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 144.2)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel import ATP-binding protein NikD (TIGR02770; HMM-score: 141)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 138.3)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 136.4)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 134.1)
    MetabolismTransport and binding proteinsOtherLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 134.1)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesglycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 132.8)
    MetabolismTransport and binding proteinsUnknown substrateanchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 132)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 130.9)
    MetabolismTransport and binding proteinsOtherpigment precursor permease (TIGR00955; HMM-score: 127.1)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 126.6)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 124.7)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 123.2)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 119.8)
    MetabolismTransport and binding proteinsOtherthiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 118.7)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 116.5)
    MetabolismTransport and binding proteinsAnionsmolybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 111.4)
    Cellular processesCellular processesOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 109.6)
    MetabolismTransport and binding proteinsOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 109.6)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminescholine ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 107.9)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharideslipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 104.3)
    MetabolismTransport and binding proteinsOtherlipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 104.3)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 103.4)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 103.4)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingABC-type bacteriocin transporter (TIGR01193; HMM-score: 103.2)
    Genetic information processingProtein fateProtein modification and repairABC-type bacteriocin transporter (TIGR01193; HMM-score: 103.2)
    MetabolismTransport and binding proteinsOtherABC-type bacteriocin transporter (TIGR01193; HMM-score: 103.2)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01846; HMM-score: 99.3)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 98.7)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 98.7)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01842; HMM-score: 97.9)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 96.5)
    MetabolismTransport and binding proteinsOtherantigen peptide transporter 2 (TIGR00958; HMM-score: 92.8)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsD-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 92.7)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 92.3)
    MetabolismEnergy metabolismMethanogenesismethyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 91.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherFeS assembly ATPase SufC (TIGR01978; HMM-score: 87)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 85.1)
    MetabolismCentral intermediary metabolismPhosphorus compoundsphosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 77.9)
    MetabolismTransport and binding proteinsOtherrim ABC transporter (TIGR01257; HMM-score: 76.3)
    MetabolismTransport and binding proteinsOtherpleiotropic drug resistance family protein (TIGR00956; HMM-score: 75.4)
    MetabolismTransport and binding proteinsAnionscystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 66.9)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairexcinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 64.4)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsglucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 60.1)
    MetabolismTransport and binding proteinsOthermulti drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 53.3)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsperoxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 52.7)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminescyclic peptide transporter (TIGR01194; HMM-score: 52)
    MetabolismTransport and binding proteinsOthercyclic peptide transporter (TIGR01194; HMM-score: 52)
    P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 30.1)
    Unknown functionGeneralsmall GTP-binding protein domain (TIGR00231; HMM-score: 24)
    helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 23.3)
    MetabolismCentral intermediary metabolismPhosphorus compoundsphosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 22.8)
    type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 21.9)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDnaA regulatory inactivator Hda (TIGR03420; HMM-score: 20.1)
    Genetic information processingDNA metabolismRestriction/modificationDNA sulfur modification protein DndD (TIGR03185; HMM-score: 19.9)
    Unknown functionGeneralMg chelatase-like protein (TIGR00368; HMM-score: 19.6)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionsdTMP kinase (TIGR00041; EC 2.7.4.9; HMM-score: 19.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMolybdopterinmolybdopterin-guanine dinucleotide biosynthesis protein B (TIGR00176; HMM-score: 18.3)
    rad50 (TIGR00606; HMM-score: 18.3)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA replication and repair protein RecF (TIGR00611; HMM-score: 18.1)
    Genetic information processingDNA metabolismDNA replication, recombination, and repaircheckpoint protein rad24 (TIGR00602; HMM-score: 18)
    MetabolismEnergy metabolismAmino acids and aminesethanolamine utilization protein, EutP (TIGR02528; HMM-score: 17.5)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesSalvage of nucleosides and nucleotidesuridine kinase (TIGR00235; EC 2.7.1.48; HMM-score: 16.7)
    Cellular processesCellular processesConjugationP-type conjugative transfer ATPase TrbB (TIGR02782; HMM-score: 16.6)
    Genetic information processingProtein synthesisTranslation factorsribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 16.1)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionsguanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 15.9)
    Cell structureCell envelopeSurface structurestwitching motility protein (TIGR01420; HMM-score: 15.3)
    Cellular processesCellular processesChemotaxis and motilitytwitching motility protein (TIGR01420; HMM-score: 15.3)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VII secretion protein EccCb (TIGR03925; HMM-score: 14.9)
    Dot/Icm secretion system ATPase DotB (TIGR02524; HMM-score: 14.6)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesLAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 14.4)
    Signal transductionRegulatory functionsProtein interactionsLAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 14.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPantothenate and coenzyme Adephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 13.9)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA 2-selenouridine synthase (TIGR03167; EC 2.9.1.-; HMM-score: 13.7)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingputative secretion ATPase, PEP-CTERM locus subfamily (TIGR03015; HMM-score: 13.5)
    Cellular processesCellular processesPathogenesistype III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 13.3)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 13.3)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 12.8)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairexonuclease SbcC (TIGR00618; HMM-score: 12.2)
    Genetic information processingProtein synthesisOtherGTP-binding protein Era (TIGR00436; HMM-score: 12)
    MetabolismCentral intermediary metabolismSulfur metabolismadenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 12)
    Cellular processesCellular processesPathogenesistype VI secretion protein IcmF (TIGR03348; HMM-score: 9.3)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 159.3)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 70.5)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 43.3)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 40.1)
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 38)
    AAA_23; AAA domain (PF13476; HMM-score: 37.1)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 34.8)
    AAA_18; AAA domain (PF13238; HMM-score: 32.5)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 31)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 30.6)
    NACHT; NACHT domain (PF05729; HMM-score: 30.5)
    G-alpha; G-protein alpha subunit (PF00503; HMM-score: 30)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 28.2)
    AAA_28; AAA domain (PF13521; HMM-score: 28.2)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 26.2)
    AAA_19; AAA domain (PF13245; HMM-score: 26.1)
    AAA_33; AAA domain (PF13671; HMM-score: 25.8)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 25.8)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 25.7)
    AAA_14; AAA domain (PF13173; HMM-score: 24.9)
    AAA_30; AAA domain (PF13604; HMM-score: 24.6)
    AAA_22; AAA domain (PF13401; HMM-score: 24.6)
    NTPase_1; NTPase (PF03266; HMM-score: 24.1)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 22)
    PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 20.7)
    MobB; Molybdopterin guanine dinucleotide synthesis protein B (PF03205; HMM-score: 20.6)
    AAA_25; AAA domain (PF13481; HMM-score: 20)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 20)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 19.6)
    Rad17; Rad17 cell cycle checkpoint protein (PF03215; HMM-score: 19.5)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 19.2)
    AAA_24; AAA domain (PF13479; HMM-score: 19)
    AAA_17; AAA domain (PF13207; HMM-score: 18.5)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 18.4)
    PRK; Phosphoribulokinase / Uridine kinase family (PF00485; HMM-score: 18.3)
    FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 18)
    ABC_ATPase; Predicted ATPase of the ABC class (PF09818; HMM-score: 17.3)
    SbcCD_C; Putative exonuclease SbcCD, C subunit (PF13558; HMM-score: 16.9)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 16.5)
    ATP_bind_1; Conserved hypothetical ATP binding protein (PF03029; HMM-score: 16.3)
    dNK; Deoxynucleoside kinase (PF01712; HMM-score: 16.3)
    Viral_helicase1; Viral (Superfamily 1) RNA helicase (PF01443; HMM-score: 16.2)
    TrwB_AAD_bind; Type IV secretion-system coupling protein DNA-binding domain (PF10412; HMM-score: 16.1)
    PIF1; PIF1-like helicase (PF05970; HMM-score: 15.9)
    Septin; Septin (PF00735; HMM-score: 15.5)
    SRPRB; Signal recognition particle receptor beta subunit (PF09439; HMM-score: 15.3)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 15.2)
    DAP3; Mitochondrial ribosomal death-associated protein 3 (PF10236; HMM-score: 15.1)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 14.9)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 14.8)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 14.2)
    ArgK; ArgK protein (PF03308; HMM-score: 14.1)
    ATP-synt_ab; ATP synthase alpha/beta family, nucleotide-binding domain (PF00006; HMM-score: 13.9)
    KAP_NTPase; KAP family P-loop domain (PF07693; HMM-score: 13.6)
    AAA_13; AAA domain (PF13166; HMM-score: 13.5)
    SRP54; SRP54-type protein, GTPase domain (PF00448; HMM-score: 13.2)
    Thymidylate_kin; Thymidylate kinase (PF02223; HMM-score: 13.2)
    FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 12.9)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 12.7)
    GvpD; GvpD gas vesicle protein (PF07088; HMM-score: 12.6)
    AAA_27; AAA domain (PF13514; HMM-score: 12.3)
    DUF815; Protein of unknown function (DUF815) (PF05673; HMM-score: 12.2)
    Pox_A32; Poxvirus A32 protein (PF04665; HMM-score: 11)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.121
    • Ymax_pos: 11
    • Cmax: 0.105
    • Cmax_pos: 52
    • Smax: 0.181
    • Smax_pos: 5
    • Smean: 0.155
    • D: 0.134
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446844712 NCBI
  • RefSeq: WP_000921968 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MLKVSDLRLKYPSGQRKIFDHLNITIQDKEKVLLLGPSGCGKSTLLNVLSGIVPNLIELPMKYDELIVDPLSGVIFQDPDSQFCMPKVYEELAFVLENRQLPREDMDALIINALNMVNLNVTPETYIKDLSGGMKQKLAIVETILQQSKTLFLDEPTAMLDVQATEDLWTKLIELWEDQTVVIVEHKVKHIWNHVDRVILMDYNGNIIADECPEIILQKYVHLLSEYGVWHPRAWEFAPSRVDFPTTNSHLLQFKNGRIIRGKSTLLSFSDLEIGLGEWITITGANGSGKTTLLESIMQLIKYQGDVYFENQRLTKIKHAAKHMYLVYQNPELQFITNSVYDEINIHFNHLSKDQSDDETIQLLKLLDLQNVKDQHPYELSIGQKRRLSVATALSSKADIIFLDEPTFGLDSHNTFQLIKLFQKRINLGQSIVMVTHDDEIIERYPSRRLKISDGALLDCDGDTNV

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS05535 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]