From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS05685 [old locus tag: SACOL1113 ]
  • pan locus tag?: SAUPAN003329000
  • symbol: SACOL_RS05685
  • pan gene symbol?:
  • synonym:
  • product: membrane protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS05685 [old locus tag: SACOL1113 ]
  • symbol: SACOL_RS05685
  • product: membrane protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1123243..1123662
  • length: 420
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (1123243..1123662) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    ATGAATAGAAAACCTGAATTAATCATGGCTTGGATTGCAAATAGTATTAGTATTATTTAT
    TTATTAGTTATGGGGCTATCCTATTTTTCTTTAAAAAGTGGTAATGCATCACAACGTGAA
    GAATTAGCGAAGCAATTATCTCAGAACGGTGGCAAGGTTTCTTTAGATATGCTTCAGACA
    ACAATGGGTGCATTAGCAATTATTTTATTAATTTCAACACTTTATGGTATATTTGCGACA
    ATTTGTATTAAAGGACGTAGAAAATTATCGATTATACTTTTTGTTATCGCGATAATTGTA
    AGTTTGATGGCTCTTAATTTAATTGCAATTGTCTTATGGGTTATCGTGATGATTATGTTG
    ATTTCTAAAAAAGAATCAAAAGAAACAACACATAAGGACGATGAGTATATTTATCATTAA
    60
    120
    180
    240
    300
    360
    420

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS05685 [old locus tag: SACOL1113 ]
  • symbol: SACOL_RS05685
  • description: membrane protein
  • length: 139
  • theoretical pI: 9.90462
  • theoretical MW: 15576.8
  • GRAVY: 0.682014

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesoligosaccharide repeat unit polymerase (TIGR04370; HMM-score: 15.2)
  • TheSEED:
  • PFAM:
    Tetraspannin (CL0347) DUF4064; Protein of unknown function (DUF4064) (PF13273; HMM-score: 71.6)
    no clan definedGWT1; GWT1 (PF06423; HMM-score: 17.8)
    DUF2663; Protein of unknown function (DUF2663) (PF10864; HMM-score: 15.1)
    Tetraspannin (CL0347) Tetraspannin; Tetraspanin family (PF00335; HMM-score: 13.8)
    no clan definedP2X_receptor; ATP P2X receptor (PF00864; HMM-score: 11.1)
    Ninjurin; Ninjurin (PF04923; HMM-score: 11.1)
    DUF1510; Protein of unknown function (DUF1510) (PF07423; HMM-score: 9.6)
    EphA2_TM; Ephrin type-A receptor 2 transmembrane domain (PF14575; HMM-score: 8.9)
    Tmemb_9; TMEM9 (PF05434; HMM-score: 8)
    DHHC; DHHC palmitoyltransferase (PF01529; HMM-score: 7.4)
    TMEM154; TMEM154 protein family (PF15102; HMM-score: 7.2)
    Sigma_reg_N; Sigma factor regulator N-terminal (PF13800; HMM-score: 6.6)
    Gx_transp (CL0315) ECF_trnsprt; ECF transporter, substrate-specific component (PF12822; HMM-score: 6.4)
    no clan definedPRA1; PRA1 family protein (PF03208; HMM-score: 6.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 3
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.213
    • Ymax_pos: 39
    • Cmax: 0.16
    • Cmax_pos: 39
    • Smax: 0.404
    • Smax_pos: 35
    • Smean: 0.183
    • D: 0.201
  • predicted transmembrane helices (TMHMM): 3

Accession numbers[edit source | edit]

  • GI: 447003206 NCBI
  • RefSeq: WP_001080462 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MNRKPELIMAWIANSISIIYLLVMGLSYFSLKSGNASQREELAKQLSQNGGKVSLDMLQTTMGALAIILLISTLYGIFATICIKGRRKLSIILFVIAIIVSLMALNLIAIVLWVIVMIMLISKKESKETTHKDDEYIYH

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS05685 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]