From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS06375 [old locus tag: SACOL1247 ]
  • pan locus tag?: SAUPAN003519000
  • symbol: SACOL_RS06375
  • pan gene symbol?: acpP
  • synonym:
  • product: acyl carrier protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS06375 [old locus tag: SACOL1247 ]
  • symbol: SACOL_RS06375
  • product: acyl carrier protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1255311..1255544
  • length: 234
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (1255311..1255544) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    GTGGAAAATTTCGATAAAGTAAAAGATATCATCGTTGACCGTTTAGGTGTAGACGCTGAT
    AAAGTAACTGAAGATGCATCTTTCAAAGATGATTTAGGCGCTGACTCACTTGATATCGCT
    GAATTAGTAATGGAATTAGAAGACGAGTTTGGTACTGAAATTCCTGATGAAGAAGCTGAA
    AAAATCAACACTGTTGGTGATGCTGTTAAATTTATTAACAGTCTTGAAAAATAA
    60
    120
    180
    234

Protein[edit source | edit]

Protein Data Bank: 4DXE

General[edit source | edit]

  • locus tag: SACOL_RS06375 [old locus tag: SACOL1247 ]
  • symbol: SACOL_RS06375
  • description: acyl carrier protein
  • length: 77
  • theoretical pI: 3.72176
  • theoretical MW: 8549.37
  • GRAVY: -0.376623

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismFatty acid and phospholipid metabolismBiosynthesisacyl carrier protein (TIGR00517; HMM-score: 109.8)
    Cellular processesCellular processesToxin production and resistancepeptide maturation system acyl carrier-related protein (TIGR04069; HMM-score: 17.9)
  • TheSEED:
  • PFAM:
    PP-binding (CL0314) PP-binding; Phosphopantetheine attachment site (PF00550; HMM-score: 59.5)
    PP-binding_2; Acyl-carrier (PF14573; HMM-score: 16.4)
    Ribosomal_L50; Ribosomal subunit 39S (PF10501; HMM-score: 15.9)
    no clan definedRibosomal_L12_N; Ribosomal protein L7/L12 dimerisation domain (PF16320; HMM-score: 13.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL_RS05055beta-ketoacyl-[acyl-carrier-protein] synthase II  [1] (data from MRSA252)
    SACOL_RS070554-hydroxybenzoyl-CoA thioesterase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.103
    • Ymax_pos: 60
    • Cmax: 0.128
    • Cmax_pos: 27
    • Smax: 0.125
    • Smax_pos: 51
    • Smean: 0.064
    • D: 0.088
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446349059 NCBI
  • RefSeq: WP_000426914 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MENFDKVKDIIVDRLGVDADKVTEDASFKDDLGADSLDIAELVMELEDEFGTEIPDEEAEKINTVGDAVKFINSLEK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS06375 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]