From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS06480 [old locus tag: SACOL1269 ]
  • pan locus tag?: SAUPAN003550000
  • symbol: SACOL_RS06480
  • pan gene symbol?: xerC
  • synonym:
  • product: tyrosine recombinase XerC

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS06480 [old locus tag: SACOL1269 ]
  • symbol: SACOL_RS06480
  • product: tyrosine recombinase XerC
  • replicon: chromosome
  • strand: +
  • coordinates: 1280539..1281435
  • length: 897
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (1280539..1281435) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    TTGAATCATATTCAAGATGCGTTTTTAAATACATTGAAAGTTGAACGGAATTTTTCGGAA
    CACACATTGAAATCATATCAAGATGACTTAATTCAGTTTAATCAATTTTTAGAACAAGAA
    CATTTAGAGTTGAATACTTTTGAATACAGAGATGCTAGAAATTATTTGAGCTATTTATAT
    TCAAATCATTTGAAAAGAACATCTGTTTCTCGTAAAATCTCAACGTTAAGAACTTTCTAT
    GAATATTGGATGACGCTTGATGAGAACATTATTAATCCATTTGTTCAATTAGTACATCCG
    AAAAAAGAAAAATATCTTCCGCAATTCTTTTACGAAGAAGAAATGGAAGCGTTATTCAAA
    ACTGTAGAAGAGGACACTTCAAAAAATTTACGGGATCGAGTTATTCTTGAATTGTTGTAT
    GCTACAGGCATCCGTGTTTCGGAATTAGTAAATATTAAAAAACAAGATATAGATTTTTAC
    GCGAATGGTGTTACCGTATTAGGAAAAGGGAGCAAAGAGCGCTTTGTACCGTTTGGTGCT
    TATTGTAGACAAAGCATCGAAAATTATTTAGAACATTTCAAACCAATTCAGTCATGCAAT
    CATGATTTTCTTATTGTAAATATGAAGGGTGAAGCAATCACTGAACGCGGTGTACGATAT
    GTTTTAAATGATATTGTTAAACGAACAGCAGGCGTAAGTGAGATTCATCCCCACAAGCTC
    AGACATACATTTGCAACGCATTTATTGAATCAAGGTGCAGACCTAAGAACAGTACAATCG
    TTATTAGGTCATGTTAATTTGTCAACAACTGGTAAATATACACACGTATCTAACCAACAA
    TTAAGAAAAGTGTATCTAAATGCACATCCTCGAGCGAAAAAGGAGAATGAAACATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    897

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS06480 [old locus tag: SACOL1269 ]
  • symbol: SACOL_RS06480
  • description: tyrosine recombinase XerC
  • length: 298
  • theoretical pI: 8.5616
  • theoretical MW: 35112.6
  • GRAVY: -0.563423

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairtyrosine recombinase XerC (TIGR02224; HMM-score: 352.2)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairtyrosine recombinase XerD (TIGR02225; HMM-score: 298.8)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairintegron integrase (TIGR02249; HMM-score: 120.5)
    Genetic information processingMobile and extrachromosomal element functionsOtherintegron integrase (TIGR02249; HMM-score: 120.5)
  • TheSEED:
  • PFAM:
    DNA-mend (CL0382) Phage_integrase; Phage integrase family (PF00589; HMM-score: 154.7)
    l-integrase_N (CL0469) Phage_int_SAM_1; Phage integrase, N-terminal SAM-like domain (PF02899; HMM-score: 63)
    Phage_int_SAM_4; Phage integrase, N-terminal SAM-like domain (PF13495; HMM-score: 34.5)
    Phage_int_SAM_5; Phage integrase SAM-like domain (PF13102; HMM-score: 21.7)
    DNA-mend (CL0382) Integrase_1; Integrase (PF12835; HMM-score: 18.6)
    Phage_integr_3; Archaeal phage integrase (PF16795; HMM-score: 15.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.114
    • Ymax_pos: 11
    • Cmax: 0.108
    • Cmax_pos: 28
    • Smax: 0.189
    • Smax_pos: 2
    • Smean: 0.134
    • D: 0.122
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446938341 NCBI
  • RefSeq: WP_001015597 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MNHIQDAFLNTLKVERNFSEHTLKSYQDDLIQFNQFLEQEHLELNTFEYRDARNYLSYLYSNHLKRTSVSRKISTLRTFYEYWMTLDENIINPFVQLVHPKKEKYLPQFFYEEEMEALFKTVEEDTSKNLRDRVILELLYATGIRVSELVNIKKQDIDFYANGVTVLGKGSKERFVPFGAYCRQSIENYLEHFKPIQSCNHDFLIVNMKGEAITERGVRYVLNDIVKRTAGVSEIHPHKLRHTFATHLLNQGADLRTVQSLLGHVNLSTTGKYTHVSNQQLRKVYLNAHPRAKKENET

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS06480 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]