From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS06495 [old locus tag: SACOL1272 ]
  • pan locus tag?: SAUPAN003553000
  • symbol: SACOL_RS06495
  • pan gene symbol?: codY
  • synonym:
  • product: GTP-sensing pleiotropic transcriptional regulator CodY

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS06495 [old locus tag: SACOL1272 ]
  • symbol: SACOL_RS06495
  • product: GTP-sensing pleiotropic transcriptional regulator CodY
  • replicon: chromosome
  • strand: +
  • coordinates: 1283471..1284244
  • length: 774
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (1283471..1284244) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAGCTTATTATCTAAAACGAGAGAGTTAAACACGTTACTTCAAAAACACAAAGGTATT
    GCGGTTGATTTTAAAGATGTAGCACAAACGATTAGTAGCGTAACTGTAACAAATGTATTT
    ATTGTATCGCGTCGAGGTAAAATTTTAGGATCGAGTCTAAATGAATTATTAAAAAGTCAA
    AGAATTATTCAAATGTTGGAAGAAAGACATATTCCAAGTGAATATACAGAACGATTAATG
    GAAGTTAAACAAACAGAATCAAATATTGATATCGACAATGTATTAACAGTATTCCCACCT
    GAAAACAGAGAATTATTCATAGATAGTCGTACAACTATCTTCCCAATTTTAGGTGGAGGG
    GAAAGATTAGGTACATTAGTACTTGGTCGAGTACATGATGATTTTAATGAAAATGATTTG
    GTACTAGGTGAATATGCTGCTACAGTTATTGGTATGGAAATCTTACGTGAGAAGCATAGT
    GAAGTAGAAAAAGAAGCGCGCGATAAAGCTGCTATTACAATGGCAATTAATTCATTATCT
    TATTCTGAAAAAGAAGCGATTGAACATATCTTTGAAGAACTTGGCGGTACGGAAGGCCTA
    TTAATCGCATCAAAAGTTGCAGATAGAGTTGGTATTACTAGATCTGTAATTGTAAATGCA
    CTACGTAAATTAGAAAGTGCTGGTGTAATTGAATCACGTTCTTTAGGAATGAAAGGTACT
    TTCATTAAAGTTAAAAAAGAAAAATTCTTAGATGAATTAGAAAAAAGTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    774

Protein[edit source | edit]

Protein Data Bank: 5EY0
Protein Data Bank: 5EY1

General[edit source | edit]

  • locus tag: SACOL_RS06495 [old locus tag: SACOL1272 ]
  • symbol: SACOL_RS06495
  • description: GTP-sensing pleiotropic transcriptional regulator CodY
  • length: 257
  • theoretical pI: 6.07842
  • theoretical MW: 28754.9
  • GRAVY: -0.178599

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Signal transductionRegulatory functionsDNA interactionsGTP-sensing transcriptional pleiotropic repressor CodY (TIGR02787; HMM-score: 351.8)
    Signal transductionRegulatory functionsDNA interactionsCRISPR locus-related DNA-binding protein (TIGR01884; HMM-score: 20.1)
    RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 15.4)
    Unknown functionGeneralRrf2 family protein (TIGR00738; HMM-score: 14.3)
  • TheSEED:
  • PFAM:
    GAF (CL0161) CodY; CodY GAF-like domain (PF06018; HMM-score: 232.3)
    HTH (CL0123) HTH_CodY; CodY helix-turn-helix domain (PF08222; HMM-score: 117.3)
    Ribosomal_S25; S25 ribosomal protein (PF03297; HMM-score: 21.6)
    MarR_2; MarR family (PF12802; HMM-score: 21.4)
    HTH_Crp_2; Crp-like helix-turn-helix domain (PF13545; HMM-score: 20.5)
    Rrf2; Transcriptional regulator (PF02082; HMM-score: 18.4)
    GntR; Bacterial regulatory proteins, gntR family (PF00392; HMM-score: 18.3)
    HTH_20; Helix-turn-helix domain (PF12840; HMM-score: 18.2)
    TrmB; Sugar-specific transcriptional regulator TrmB (PF01978; HMM-score: 17.4)
    MarR; MarR family (PF01047; HMM-score: 16.5)
    HTH_11; HTH domain (PF08279; HMM-score: 16.4)
    HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 15.9)
    HTH_41; Helix-turn-helix domain (PF14502; HMM-score: 14.4)
    GAF (CL0161) GAF_2; GAF domain (PF13185; HMM-score: 14.3)
    no clan definedCoiled-coil_56; Coiled-coil domain-containing protein 56 (PF09813; HMM-score: 13.1)
    HTH (CL0123) HxlR; HxlR-like helix-turn-helix (PF01638; HMM-score: 12.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.178
    • Ymax_pos: 22
    • Cmax: 0.127
    • Cmax_pos: 22
    • Smax: 0.327
    • Smax_pos: 19
    • Smean: 0.241
    • D: 0.202
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 445977482 NCBI
  • RefSeq: WP_000055337 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MSLLSKTRELNTLLQKHKGIAVDFKDVAQTISSVTVTNVFIVSRRGKILGSSLNELLKSQRIIQMLEERHIPSEYTERLMEVKQTESNIDIDNVLTVFPPENRELFIDSRTTIFPILGGGERLGTLVLGRVHDDFNENDLVLGEYAATVIGMEILREKHSEVEKEARDKAAITMAINSLSYSEKEAIEHIFEELGGTEGLLIASKVADRVGITRSVIVNALRKLESAGVIESRSLGMKGTFIKVKKEKFLDELEKSK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS06495 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]