From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS07425 [old locus tag: SACOL1455 ]
  • pan locus tag?: SAUPAN003849000
  • symbol: SACOL_RS07425
  • pan gene symbol?: ctpA
  • synonym:
  • product: serine protease

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS07425 [old locus tag: SACOL1455 ]
  • symbol: SACOL_RS07425
  • product: serine protease
  • replicon: chromosome
  • strand: -
  • coordinates: 1469477..1470967
  • length: 1491
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (1469477..1470967) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    ATGGATGATAAGCAACACACATCTTCATCCGATGATGAACGCGCTGAAATTGCAACAAGC
    AATCAAGACCAAGAAACTAATTCATCGAAACGCGTTCACTTAAAACGTTGGCAATTCATA
    TCAATATTAATTGGTACAATCCTAATAACAGCTGTCATCACAGTTGTTGCATATATTTTT
    ATAAATCAAAAAATAAGTGGTTTAAACAAAACTGATCAATCAAACTTAAATAAAATTGAA
    AATGTGTATAAAATCTTAAATAGTGATTATTACAAAAAACAGGACTCTGACAAGTTAAGT
    AAAGCTGCAATTGATGGCATGGTCAAAGAATTAAAAGATCCTTATTCTGAATATTTAACA
    AAAGAACAAACGAAATCCTTTAATGAAGGTGTTTCAGGTGATTTTGTAGGTATTGGTGCA
    GAAATGCAAAAGAAAAATGATCAAATTATGGTTACTAGTCCTATGAAGGGATCTCCAGCA
    GAACGTGCTGGCATTCGTCCTAAAGATGTCATTACTAAAGTAAATGGAAAATCAATTAAA
    GGTAAAGCATTAGATGAAGTTGTCAAAGATGTTCGTGGTAAAGAAAACACTGAAGTCACT
    TTAACTGTTCAACGAGGTAGTGAAGAAAAAGACGTTAAGATTAAACGTGAAAAAATTCAT
    GTTAAAAGTGTTGAGTATAAGAAAAAAGGTAAAGTTGGAGTTATTACTATTAATAAATTC
    CAGAATGATACATCAGGTGAATTGAAAGATGCAGTTCTAAAAGCTCACAAAGATGGTTTG
    AAAAAGATTGTTTTAGATTTAAGAAATAATCCAGGTGGACTACTAGATGAAGCTGTTAAA
    ATGGCAAATATTTTTATCGATAAAGGAAAAACTGTTGTTAAACTAGAAAAAGGTAAAGAT
    ACTGAAGCAATTCAAACTTCTAATGATGCGTTAAAAGAAGCGAAAGACATGGATATATCC
    ATCTTAGTGAATGAAGGTTCAGCTAGCGCTTCTGAAGTGTTTACTGGTGCGCTAAAAGAC
    TATAATAAAGCTAAAGTTTATGGGTCAAAAACATTCGGCAAAGGTGTCGTACAAACTACA
    AGAGAGTTTAAGGATGGTTCATTGTTAAAATATACTGAAATGAAATGGTTAACGCCAGAT
    GGTCATTATATTCACGGTAAAGGCATTAAACCAGACGTTACTATTGACACACCTAAATAT
    CAATCTTTAAATGTCATTCCTAATACGAAAACATTTAAAGTTGGAGACGATGATAAAAAT
    ATTAAAACTATTAAAATTGGTTTATCAGCTTTAGGTTATAAAGTTGATAATGAATCAACG
    CAATTTGATAAAGCTTTAGAAAATCAAGTTAAAGCTTTCCAACAAGCGAATAAACTTGAG
    GTAACTGGTGAATTTAATAAAGAAACGAATAATAAATTTACTGAGTTATTAGTTGAAAAA
    GCTAATAAACATGATGATGTTCTCGATAAGTTGATTAATATTTTAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1491

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS07425 [old locus tag: SACOL1455 ]
  • symbol: SACOL_RS07425
  • description: serine protease
  • length: 496
  • theoretical pI: 9.7491
  • theoretical MW: 55276.6
  • GRAVY: -0.639718

Function[edit source | edit]

  • reaction:
    EC 3.4.21.-?  ExPASy
  • TIGRFAM:
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesC-terminal processing peptidase (TIGR00225; EC 3.4.21.-; HMM-score: 344)
    Genetic information processingProtein fateProtein modification and repairC-terminal processing peptidase (TIGR00225; EC 3.4.21.-; HMM-score: 344)
    putative carboxyl-terminal-processing protease, deltaproteobacterial (TIGR03900; EC 3.4.21.-; HMM-score: 264.2)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidespeptidase Do (TIGR02037; EC 3.4.21.-; HMM-score: 36.4)
    Genetic information processingProtein fateProtein folding and stabilizationpeptidase Do (TIGR02037; EC 3.4.21.-; HMM-score: 36.4)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesRIP metalloprotease RseP (TIGR00054; EC 3.4.24.-; HMM-score: 27)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesperiplasmic serine peptidase DegS (TIGR02038; EC 3.4.21.-; HMM-score: 20.2)
    Signal transductionRegulatory functionsProtein interactionsperiplasmic serine peptidase DegS (TIGR02038; EC 3.4.21.-; HMM-score: 20.2)
    Cellular processesCellular processesSporulation and germinationspore cortex-lytic enzyme (TIGR02869; HMM-score: 18.7)
    Signal transductionRegulatory functionsProtein interactionsanti-anti-sigma factor (TIGR00377; HMM-score: 12.1)
  • TheSEED:
  • PFAM:
    ClpP_crotonase (CL0127) Peptidase_S41; Peptidase family S41 (PF03572; HMM-score: 165.5)
    PDZ-like (CL0466) PDZ_2; PDZ domain (PF13180; HMM-score: 56.2)
    PDZ; PDZ domain (Also known as DHR or GLGF) (PF00595; HMM-score: 49.8)
    PGBD (CL0244) PG_binding_1; Putative peptidoglycan binding domain (PF01471; HMM-score: 46.5)
    PDZ-like (CL0466) Tricorn_PDZ; Tricorn protease PDZ domain (PF14685; HMM-score: 17)
    PGBD (CL0244) PG_binding_2; Putative peptidoglycan binding domain (PF08823; HMM-score: 14.6)
    C_Lectin (CL0056) Ly49; Ly49-like protein, N-terminal region (PF08391; HMM-score: 13)
    no clan definedDUF3394; Domain of unknown function (DUF3394) (PF11874; HMM-score: 9.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.17
    • Cytoplasmic Membrane Score: 9.51
    • Cellwall Score: 0.16
    • Extracellular Score: 0.15
    • Internal Helix: 1
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.113
    • Ymax_pos: 50
    • Cmax: 0.116
    • Cmax_pos: 58
    • Smax: 0.156
    • Smax_pos: 39
    • Smean: 0.09
    • D: 0.104
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

  • GI: 446264275 NCBI
  • RefSeq: WP_000342130 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MDDKQHTSSSDDERAEIATSNQDQETNSSKRVHLKRWQFISILIGTILITAVITVVAYIFINQKISGLNKTDQSNLNKIENVYKILNSDYYKKQDSDKLSKAAIDGMVKELKDPYSEYLTKEQTKSFNEGVSGDFVGIGAEMQKKNDQIMVTSPMKGSPAERAGIRPKDVITKVNGKSIKGKALDEVVKDVRGKENTEVTLTVQRGSEEKDVKIKREKIHVKSVEYKKKGKVGVITINKFQNDTSGELKDAVLKAHKDGLKKIVLDLRNNPGGLLDEAVKMANIFIDKGKTVVKLEKGKDTEAIQTSNDALKEAKDMDISILVNEGSASASEVFTGALKDYNKAKVYGSKTFGKGVVQTTREFKDGSLLKYTEMKWLTPDGHYIHGKGIKPDVTIDTPKYQSLNVIPNTKTFKVGDDDKNIKTIKIGLSALGYKVDNESTQFDKALENQVKAFQQANKLEVTGEFNKETNNKFTELLVEKANKHDDVLDKLINILK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS07425 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]