From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS08585 [old locus tag: SACOL1683 ]
  • pan locus tag?: SAUPAN004231000
  • symbol: SACOL_RS08585
  • pan gene symbol?:
  • synonym:
  • product: tRNA threonylcarbamoyladenosine dehydratase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS08585 [old locus tag: SACOL1683 ]
  • symbol: SACOL_RS08585
  • product: tRNA threonylcarbamoyladenosine dehydratase
  • replicon: chromosome
  • strand: -
  • coordinates: 1712034..1712807
  • length: 774
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (1712034..1712807) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAAACATCAATTTTCAAGAAATGAACTAGCGATTGGACAACAAGGTTTAGATTTATTG
    AAGCAACAAACTGTTGTCATACTTGGCGTTGGAGGTGTTGGTTCATTTGCTGCTGAAGCA
    TTAGCAAGAACGAATATTGGTCATATTATATTAATAGATAAAGATGATGTTGATATTACA
    AATGTAAACAGACAATTACACGCTTTAACTACAACGGTAGGACAAAGTAAAGTTTCTTTG
    ATGGAAGAACGTATTAAATTAATTAATCCAGATTGTAAAGTCACGCCCTTACATATGTTT
    TATACAGAAGAGACATATGAAGAAATTTTCGATAACTACGATATAGATTATTTTGTAGAT
    GCAAGTGATACAATAATGTACAAAGTACACTTAATGAAAGAGTGTCTTGACCGAGGGATT
    AAAGTGATTTCCAGTATGGGTGCTGCAAATAAAACAGATCCAACACGTTTTACAATTTCA
    GATATCTCTAAAACACATACCGATCCAATGGCCAAAATTATTCGTCAAAAATTGAAAAAA
    CTAGGAATTCGTAAAGGGATTCCAGTTGTATTTTCAGATGAAAGTCCAATTGTCATAAGA
    GAAGATGTAAAAGATATAGTTGGAGATAAAAATGCTATCAATCGAAAAGGACAAATGCCA
    CCTTCTTCAAATGCCTTTGTGCCAAGTGTTGTTGGATTAATTTGTGCAAGTTATGTGGTG
    AATGACGTATTAAAAGATATTCCAGTTCGTCGCATTAAAGACAAAGGGCAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    774

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS08585 [old locus tag: SACOL1683 ]
  • symbol: SACOL_RS08585
  • description: tRNA threonylcarbamoyladenosine dehydratase
  • length: 257
  • theoretical pI: 8.07957
  • theoretical MW: 28641
  • GRAVY: -0.161479

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis adenylyltransferase ThiF (TIGR02356; EC 2.7.7.73; HMM-score: 84.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMolybdopterinmolybdopterin synthase sulfurylase MoeB (TIGR02355; HMM-score: 77.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiamine biosynthesis protein ThiF (TIGR02354; HMM-score: 72.9)
    PRTRC system ThiF family protein (TIGR03736; HMM-score: 24.1)
    ubiquitin-activating enzyme E1 (TIGR01408; HMM-score: 19.5)
    E1-like protein-activating enzyme Gsa7p/Apg7p (TIGR01381; HMM-score: 18.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminglutamyl-tRNA reductase (TIGR01035; EC 1.2.1.70; HMM-score: 17.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPantothenate and coenzyme A2-dehydropantoate 2-reductase (TIGR00745; EC 1.1.1.-; HMM-score: 16.1)
    Cellular processesCellular processesDetoxificationS-(hydroxymethyl)mycothiol dehydrogenase (TIGR03451; EC 1.1.1.306; HMM-score: 15.3)
    Genetic information processingProtein fateProtein folding and stabilizationxanthine dehydrogenase accessory protein XdhC (TIGR02964; HMM-score: 14.3)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesOtherxanthine dehydrogenase accessory protein XdhC (TIGR02964; HMM-score: 14.3)
    6-hydroxycyclohex-1-ene-1-carbonyl-CoA dehydrogenase (TIGR03201; EC 1.1.1.-; HMM-score: 13.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 12.1)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) ThiF; ThiF family (PF00899; HMM-score: 115.6)
    Sacchrp_dh_NADP; Saccharopine dehydrogenase NADP binding domain (PF03435; HMM-score: 22.3)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 16.9)
    ApbA; Ketopantoate reductase PanE/ApbA (PF02558; HMM-score: 16.5)
    2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 14.6)
    UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 14.4)
    Shikimate_DH; Shikimate / quinate 5-dehydrogenase (PF01488; HMM-score: 13.9)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 12.3)
    Trp_halogenase; Tryptophan halogenase (PF04820; HMM-score: 10.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.205
    • Ymax_pos: 43
    • Cmax: 0.199
    • Cmax_pos: 43
    • Smax: 0.316
    • Smax_pos: 34
    • Smean: 0.133
    • D: 0.177
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446605300 NCBI
  • RefSeq: WP_000682646 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKHQFSRNELAIGQQGLDLLKQQTVVILGVGGVGSFAAEALARTNIGHIILIDKDDVDITNVNRQLHALTTTVGQSKVSLMEERIKLINPDCKVTPLHMFYTEETYEEIFDNYDIDYFVDASDTIMYKVHLMKECLDRGIKVISSMGAANKTDPTRFTISDISKTHTDPMAKIIRQKLKKLGIRKGIPVVFSDESPIVIREDVKDIVGDKNAINRKGQMPPSSNAFVPSVVGLICASYVVNDVLKDIPVRRIKDKGQ

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS08585 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]