From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS09820 [old locus tag: SACOL1907 ]
  • pan locus tag?: SAUPAN004783000
  • symbol: SACOL_RS09820
  • pan gene symbol?:
  • synonym:
  • product: RNA pseudouridine synthase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS09820 [old locus tag: SACOL1907 ]
  • symbol: SACOL_RS09820
  • product: RNA pseudouridine synthase
  • replicon: chromosome
  • strand: +
  • coordinates: 1962282..1963103
  • length: 822
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (1962282..1963103) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGAAATTTAAAATACCAGAAAACTTTAATGACTTAAGTTTACGAGATATTTTCCAACAA
    CTTAAGGTACCTAAAAAAGATTTACATCATTTAAATATGTCTAAAGATATTACTATTAAT
    GATAAACCTGCGCGATTAATGGATAAAGTGCATACTGGCGACGATGTATTTGTTCCAACC
    ATCGATGAAAAAAGTAATTATGTTCCAAGTTATCGTTATGCACAAATTAAATACGAAGAC
    GATGATATGGCAATCGTAATGAAACCTAAAGGTGTTAAGACTCACCCTAATGATTTAAAA
    GAAAGCAATACTTTAATGAATCATGTGATTTACACTATTGATAGTGACTATGTCGAACCA
    ATTCATCGACTGGACCAGGAAACAGTAGGATTATTAATTGTTGCTAAAAATCCTTTAATG
    AAAAAAATTCTTGATCGCATGTTAGAAGACAATGATATTACGCGGATATACAAAGCAAAT
    GTTAAGGCACTTTTACCTTTAAAACCACAAACGATTGATATGCCAATTGGTAAAGATAAA
    TTCCATTCGAATAAACGACGTGTGTCTCCTACTGGACAGCGTGCAATTACACACATTTTA
    ACTTCAAAAATGATAAAAGAAGCTGTGTGCCAACTTGAAATCAAGTTGGATACTGGACGT
    ACTCATCAAATTCGTGTGCATTTAGCTGAAATTGGTCACCCTGTTATTGGTGATCCTTTA
    TATGGTGATTCAACGTTAAGACAATTAGAACTTGAAAGTTACAAAATAGAGTTTGTGCAT
    CCCTTGACTAAGGAAGTCATTTCCGTTTCTTTGGATGACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    822

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS09820 [old locus tag: SACOL1907 ]
  • symbol: SACOL_RS09820
  • description: RNA pseudouridine synthase
  • length: 273
  • theoretical pI: 7.90273
  • theoretical MW: 31440.2
  • GRAVY: -0.469597

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA and rRNA base modificationpseudouridine synthase, RluA family (TIGR00005; EC 5.4.99.-; HMM-score: 188.2)
    Genetic information processingProtein synthesistRNA and rRNA base modificationpseudouridine synthase Rlu family protein, TIGR01621 (TIGR01621; EC 5.4.99.-; HMM-score: 72)
    Genetic information processingProtein synthesistRNA and rRNA base modificationpseudouridine synthase (TIGR00093; EC 5.4.99.-; HMM-score: 33.7)
    Genetic information processingTranscriptionTranscription factorstranscription termination/antitermination factor NusG (TIGR00922; HMM-score: 12.4)
  • TheSEED:
  • PFAM:
    PseudoU_synth (CL0649) PseudoU_synth_2; RNA pseudouridylate synthase (PF00849; HMM-score: 87.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.112
    • Ymax_pos: 27
    • Cmax: 0.116
    • Cmax_pos: 47
    • Smax: 0.175
    • Smax_pos: 25
    • Smean: 0.112
    • D: 0.112
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446592030 NCBI
  • RefSeq: WP_000669376 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKFKIPENFNDLSLRDIFQQLKVPKKDLHHLNMSKDITINDKPARLMDKVHTGDDVFVPTIDEKSNYVPSYRYAQIKYEDDDMAIVMKPKGVKTHPNDLKESNTLMNHVIYTIDSDYVEPIHRLDQETVGLLIVAKNPLMKKILDRMLEDNDITRIYKANVKALLPLKPQTIDMPIGKDKFHSNKRRVSPTGQRAITHILTSKMIKEAVCQLEIKLDTGRTHQIRVHLAEIGHPVIGDPLYGDSTLRQLELESYKIEFVHPLTKEVISVSLDD

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS09820 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]