From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS10155 [old locus tag: SACOL1942 ]
  • pan locus tag?: SAUPAN004899000
  • symbol: SACOL_RS10155
  • pan gene symbol?: vraR
  • synonym:
  • product: DNA-binding response regulator

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS10155 [old locus tag: SACOL1942 ]
  • symbol: SACOL_RS10155
  • product: DNA-binding response regulator
  • replicon: chromosome
  • strand: -
  • coordinates: 2004941..2005570
  • length: 630
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (2004941..2005570) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGACGATTAAAGTATTGTTTGTGGATGATCATGAAATGGTACGTATAGGAATTTCAAGT
    TATCTATCAACGCAAAGTGATATTGAAGTAGTTGGTGAAGGCGCTTCTGGTAAAGAAGCA
    ATTGCCAAAGCCCATGAGTTGAAGCCAGATTTAATTTTAATGGATTTACTTATGGATGAC
    ATGGATGGTGTAGAAGCGACGACTCAGATTAAAAAAGATTTACCGCAAATTAAAGTATTA
    ATGTTAACTAGTTTTATTGAAGATAAAGAGGTATATCGTGCATTAGATGCAGGTGTCGAT
    AGTTACATTTTAAAAACAACAAGTGCAAAAGATATCGCCGATGCAGTTCGTAAAACTTCT
    AGAGGAGAATCTGTTTTTGAACCGGAAGTTTTAGTGAAAATGCGTAACCGTATGAAAAAG
    CGCGCAGAGTTATATGAAATGCTTACAGAACGAGAAATGGAAATATTATTATTGATTGCG
    AAAGGTTACTCAAATCAAGAAATTGCTAGTGCATCGCATATTACTATTAAAACGGTTAAG
    ACACATGTGAGTAACATTTTAAGTAAGTTAGAAGTGCAAGATAGAACACAAGCTGTTATC
    TATGCATTCCAACATAATTTAATTCAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    630

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS10155 [old locus tag: SACOL1942 ]
  • symbol: SACOL_RS10155
  • description: DNA-binding response regulator
  • length: 209
  • theoretical pI: 5.39084
  • theoretical MW: 23545.2
  • GRAVY: -0.121531

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cellular processesCellular processesSporulation and germinationsporulation transcription factor Spo0A (TIGR02875; HMM-score: 72.3)
    transcriptional regulator EpsA (TIGR03020; HMM-score: 55.8)
    Signal transductionRegulatory functionsDNA interactionsphosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 55.6)
    Signal transductionSignal transductionTwo-component systemsphosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 55.6)
    Signal transductionRegulatory functionsDNA interactionsheavy metal response regulator (TIGR01387; HMM-score: 36.5)
    MetabolismCentral intermediary metabolismNitrogen metabolismnitrogen regulation protein NR(I) (TIGR01818; HMM-score: 36.5)
    Signal transductionRegulatory functionsDNA interactionsnitrogen regulation protein NR(I) (TIGR01818; HMM-score: 36.5)
    Signal transductionSignal transductionTwo-component systemsnitrogen regulation protein NR(I) (TIGR01818; HMM-score: 36.5)
    LuxR family transcriptional regulatory, chaperone HchA-associated (TIGR03541; HMM-score: 34)
    RNA polymerase sigma-70 factor, Bacteroides expansion family 1 (TIGR02985; HMM-score: 26.4)
    Signal transductionSignal transductionTwo-component systemsTMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 25.5)
    RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 21.1)
    Cellular processesCellular processesSporulation and germinationRNA polymerase sigma-H factor (TIGR02859; HMM-score: 17.2)
    Genetic information processingTranscriptionTranscription factorsRNA polymerase sigma-H factor (TIGR02859; HMM-score: 17.2)
    proteobacterial dedicated sortase system response regulator (TIGR03787; HMM-score: 15.8)
    RNA polymerase sigma-70 factor, sigma-E family (TIGR02983; HMM-score: 13.4)
  • TheSEED:
  • PFAM:
    CheY (CL0304) Response_reg; Response regulator receiver domain (PF00072; HMM-score: 93.9)
    HTH (CL0123) GerE; Bacterial regulatory proteins, luxR family (PF00196; HMM-score: 71.5)
    Sigma70_r4_2; Sigma-70, region 4 (PF08281; HMM-score: 34.2)
    HTH_23; Homeodomain-like domain (PF13384; HMM-score: 16.9)
    HTH_40; Helix-turn-helix domain (PF14493; HMM-score: 16.6)
    HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 15.6)
    UPF0122; Putative helix-turn-helix protein, YlxM / p13 like (PF04297; HMM-score: 15.6)
    Sigma70_r4; Sigma-70, region 4 (PF04545; HMM-score: 15)
    no clan definedDUF3194; Protein of unknown function (DUF3194) (PF11419; HMM-score: 13.9)
    PDDEXK (CL0236) PDDEXK_10; PD-(D/E)XK nuclease superfamily (PF07788; HMM-score: 13.3)
    NADP_Rossmann (CL0063) B12-binding; B12 binding domain (PF02310; HMM-score: 13.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.135
    • Ymax_pos: 38
    • Cmax: 0.15
    • Cmax_pos: 38
    • Smax: 0.157
    • Smax_pos: 31
    • Smean: 0.095
    • D: 0.119
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446075675 NCBI
  • RefSeq: WP_000153530 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MTIKVLFVDDHEMVRIGISSYLSTQSDIEVVGEGASGKEAIAKAHELKPDLILMDLLMDDMDGVEATTQIKKDLPQIKVLMLTSFIEDKEVYRALDAGVDSYILKTTSAKDIADAVRKTSRGESVFEPEVLVKMRNRMKKRAELYEMLTEREMEILLLIAKGYSNQEIASASHITIKTVKTHVSNILSKLEVQDRTQAVIYAFQHNLIQ

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS10155 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]