From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS10260 [old locus tag: SACOL1962 ]
  • pan locus tag?: SAUPAN004928000
  • symbol: SACOL_RS10260
  • pan gene symbol?: gatC
  • synonym:
  • product: aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS10260 [old locus tag: SACOL1962 ]
  • symbol: SACOL_RS10260
  • product: aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C
  • replicon: chromosome
  • strand: -
  • coordinates: 2023183..2023485
  • length: 303
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (2023183..2023485) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    ATGACAAAAGTAACACGTGAAGAAGTTGAGCATATCGCGAATCTTGCAAGACTTCAAATT
    TCTCCTGAAGAAACGGAAGAAATGGCCAACACATTAGAAAGCATTTTAGATTTTGCAAAA
    CAAAATGATAGCGCTGATACAGAAGGCGTTGAACCTACATATCACGTTTTAGATTTACAA
    AACGTTTTACGTGAAGATAAAGCAATTAAAGGTATTCCACAAGAATTAGCTTTGAAAAAT
    GCCAAAGAAACAGAAGATGGACAATTTAAAGTGCCTACAATCATGAATGAGGAGGACGCG
    TAA
    60
    120
    180
    240
    300
    303

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS10260 [old locus tag: SACOL1962 ]
  • symbol: SACOL_RS10260
  • description: aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C
  • length: 100
  • theoretical pI: 4.09552
  • theoretical MW: 11267.4
  • GRAVY: -0.692

Function[edit source | edit]

  • reaction:
    EC 6.3.5.-?  ExPASy
    ATP + L-glutamyl-tRNA(Gln) + L-glutamine = ADP + phosphate + L-glutaminyl-tRNA(Gln) + L-glutamate?
    ATP + L-aspartyl-tRNA(Asn) + L-glutamine = ADP + phosphate + L-asparaginyl-tRNA(Asn) + L-glutamate?
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA aminoacylationaspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase, C subunit (TIGR00135; EC 6.3.5.-; HMM-score: 96.6)
    putative Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase, subunit C (TIGR01827; HMM-score: 21.3)
  • TheSEED:
  • PFAM:
    no clan definedGlu-tRNAGln; Glu-tRNAGln amidotransferase C subunit (PF02686; HMM-score: 75.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.115
    • Ymax_pos: 30
    • Cmax: 0.153
    • Cmax_pos: 46
    • Smax: 0.15
    • Smax_pos: 3
    • Smean: 0.095
    • D: 0.108
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446092307 NCBI
  • RefSeq: WP_000170162 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MTKVTREEVEHIANLARLQISPEETEEMANTLESILDFAKQNDSADTEGVEPTYHVLDLQNVLREDKAIKGIPQELALKNAKETEDGQFKVPTIMNEEDA

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS10260 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]