From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS11990 [old locus tag: SACOL2281 ]
  • pan locus tag?: SAUPAN005754000
  • symbol: SACOL_RS11990
  • pan gene symbol?: ureB
  • synonym:
  • product: urease subunit beta

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS11990 [old locus tag: SACOL2281 ]
  • symbol: SACOL_RS11990
  • product: urease subunit beta
  • replicon: chromosome
  • strand: +
  • coordinates: 2341912..2342322
  • length: 411
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (2341912..2342322) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    ATGATACCAGGAGAAATTATTACAAAAAGTACAGAGGTTGAAATTAATAACCATCATCCT
    GAAACAGTTATCGAAGTTGAAAATACAGGAGATCGACCAATTCAAGTGGGCTCACATTTT
    CATTTTTATGAAGCAAATGCAGCATTAGATTTCGAACGTGAAATGGCATATGGAAAACAT
    TTAGATATTCCAGCTGGAGCAGCTGTTCGATTTGAACCTGGGGATAAAAAAGAAGTTCAA
    TTAGTTGAATATGCTGGCAAACGTAAAATTTTTGGTTTTCGTGGTATGGTCAATGGTCCT
    ATCGATGAGTCACGTGTCTATCGCCCAACTGATGAAAATGATGAATATGCAGGTGTATTC
    GGAGATAACGGTGCTGAAAACGTGAATAAAAAAGGAGGAAAAAGATCATGA
    60
    120
    180
    240
    300
    360
    411

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS11990 [old locus tag: SACOL2281 ]
  • symbol: SACOL_RS11990
  • description: urease subunit beta
  • length: 136
  • theoretical pI: 5.05109
  • theoretical MW: 15164.7
  • GRAVY: -0.725

Function[edit source | edit]

  • reaction:
    EC 3.5.1.5?  ExPASy
    UreaseUrea + H2O = CO2 + 2 NH3
  • TIGRFAM:
    MetabolismCentral intermediary metabolismNitrogen metabolismurease, beta subunit (TIGR00192; EC 3.5.1.5; HMM-score: 150.2)
  • TheSEED:
  • PFAM:
    no clan definedUrease_beta; Urease beta subunit (PF00699; HMM-score: 146.9)
    PapD-like (CL0556) PapD_N; Pili and flagellar-assembly chaperone, PapD N-terminal domain (PF00345; HMM-score: 12.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.113
    • Ymax_pos: 27
    • Cmax: 0.11
    • Cmax_pos: 48
    • Smax: 0.143
    • Smax_pos: 22
    • Smean: 0.093
    • D: 0.105
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446534782 NCBI
  • RefSeq: WP_000612128 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MIPGEIITKSTEVEINNHHPETVIEVENTGDRPIQVGSHFHFYEANAALDFEREMAYGKHLDIPAGAAVRFEPGDKKEVQLVEYAGKRKIFGFRGMVNGPIDESRVYRPTDENDEYAGVFGDNGAENVNKKGGKRS

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS11990 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]