From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS14310 [old locus tag: SACOL2738 ]
  • pan locus tag?: SAUPAN006489000
  • symbol: SACOL_RS14310
  • pan gene symbol?: trmE
  • synonym:
  • product: tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS14310 [old locus tag: SACOL2738 ]
  • symbol: SACOL_RS14310
  • product: tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
  • replicon: chromosome
  • strand: -
  • coordinates: 2807106..2808485
  • length: 1380
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (2807106..2808485) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    ATGGATTTAGATACAATTACGAGTATTTCAACACCAATGGGTGAAGGGGCAATTGGAATT
    GTTCGATTGTCTGGACCGCAAGCCGTTGAAATTGCTGACAAATTATATAAAGGAAAACAT
    CTTTTAAATGATGTTCCATCACATACGATTAATTACGGTCATATTATTGATCCAGAGTCT
    AAAGAAGTGATTGAAGAAGTTATGGTGTCTGTGTTAAGAGCGCCAAAAACATTTACACGC
    GAAGATATTATAGAAATTAATTGTCATGGTGGTATTTTAACGATTAATAGAGTGCTGGAA
    CTTACTATGACATATGGCGCTAGAATGGCTGAGCCAGGTGAATTTACAAAACGTGCCTTT
    TTAAATGGTCGTATTGATTTATCTCAAGCTGAAGCAGTTATGGACTTTATTCGCTCGAAG
    ACAGATAGAGCTTCTAAAGTTGCGATGAATCAAATTGAAGGTCGTCTAAGTGACTTAATC
    AAAAAACAACGTCAATCTATATTAGAGATACTCGCTCAAGTGGAAGTGAATATTGATTAT
    CCTGAATACGATGATGTTGAAGATGCGACTACTGAATTTCTTTTAGAGCAGTCTAAAGAA
    ATCAAACAGGAAATTAATCGTTTATTAGATACCGGTGCGCAGGGTAAAATTATGCGTGAA
    GGTTTATCTACAGTTATTGTTGGTAAACCAAACGTAGGTAAATCATCGATGTTAAATAAT
    TTAATACAAGATAATAAAGCGATTGTAACTGAGGTAGCAGGTACTACTAGAGATGTCTTA
    GAAGAGTACGTCAATGTTCGTGGCGTGCCATTAAGATTAGTTGATACTGCTGGTATACGT
    GAGACAGAAGATATAGTAGAGAAGATTGGTGTTGAACGCTCTAGAAAGGCTCTTAGCCAA
    GCAGACTTAATTTTATTTGTATTAAACAATAACGAAGCATTGACTCAAGAAGATTACACA
    TTATATGAAGTGGTTAAAAATGAAGATGTAATCGTAATTGTTAATAAAATGGATTTAGAG
    CAAAACATAGATATTAATGAAGTTAAAGATATGATAGGTGATACGCCATTAATTCAAACT
    TCAATGTTAAAACAAGAAGGTATTGATGAATTAGAAATACAAATTCGAGATTTGTTCTTT
    GGTGGAGAAGTACAAAATCAAGATATGACTTATGTTTCTAATTCAAGACATATTTCATTA
    TTAAAACAAGCAAGACAAACGATACAAGATGCGATTGATGCAGCAGAATCTGGTGTGCCT
    ATGGATATGGTACAAATTGATTTAACTAGAACTTGGGAAATATTAGGAGAAATTATTGGT
    GAGACTGCAAGTGATGAACTCATCGATCAGTTATTCAGTCAATTCTGCTTAGGTAAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS14310 [old locus tag: SACOL2738 ]
  • symbol: SACOL_RS14310
  • description: tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
  • length: 459
  • theoretical pI: 4.30301
  • theoretical MW: 51355.2
  • GRAVY: -0.206536

Function[edit source | edit]

  • reaction:
    EC 3.6.-.-?  ExPASy
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 434.5)
    Genetic information processingProtein synthesisOtherribosome-associated GTPase EngA (TIGR03594; HMM-score: 115.9)
    Unknown functionGeneralsmall GTP-binding protein domain (TIGR00231; HMM-score: 91.5)
    Genetic information processingProtein fateProtein modification and repair[FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 90.6)
    Genetic information processingProtein synthesisOtherGTP-binding protein Era (TIGR00436; HMM-score: 67.9)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsferrous iron transport protein B (TIGR00437; HMM-score: 53.1)
    Genetic information processingProtein synthesisOtherribosome biogenesis GTP-binding protein YlqF (TIGR03596; HMM-score: 48.9)
    Genetic information processingProtein synthesisOtherribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 38)
    Genetic information processingProtein synthesisOtherribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 25.9)
    Genetic information processingProtein synthesisOtherObg family GTPase CgtA (TIGR02729; HMM-score: 22.7)
    MetabolismTransport and binding proteinsAmino acids, peptides and amineschloroplast protein import component Toc86/159, G and M domains (TIGR00993; HMM-score: 20.7)
    Genetic information processingProtein synthesisTranslation factorsribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 19.3)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionsguanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 14.3)
    MetabolismTransport and binding proteinsNucleosides, purines and pyrimidinesGTP-binding protein (TIGR00991; HMM-score: 14.1)
  • TheSEED:
  • PFAM:
    no clan definedMnmE_helical; MnmE helical domain (PF12631; HMM-score: 195.8)
    FBD (CL0289) TrmE_N; GTP-binding protein TrmE N-terminus (PF10396; HMM-score: 133.4)
    P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 86.5)
    FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 44.7)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 31.6)
    Ras; Ras family (PF00071; HMM-score: 30.5)
    AIG1; AIG1 family (PF04548; HMM-score: 29.5)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 26.9)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 22.9)
    Gtr1_RagA; Gtr1/RagA G protein conserved region (PF04670; HMM-score: 21.6)
    GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 21.1)
    SRPRB; Signal recognition particle receptor beta subunit (PF09439; HMM-score: 14.7)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 13.3)
    Arf; ADP-ribosylation factor family (PF00025; HMM-score: 11.4)
    GHD (CL0369) Cyc-maltodext_C; Cyclo-malto-dextrinase C-terminal domain (PF10438; HMM-score: 10.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: K+
  • effectors:
  • protein partners:
    SACOL_RS00185PBP2a family beta-lactam-resistant peptidoglycan transpeptidase MecA  [1] (data from MRSA252)
    SACOL_RS0650530S ribosomal protein S2  [1] (data from MRSA252)
    SACOL_RS11435Asp23/Gls24 family envelope stress response protein  [1] (data from MRSA252)
    SACOL_RS1169530S ribosomal protein S5  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.17
    • Ymax_pos: 32
    • Cmax: 0.198
    • Cmax_pos: 32
    • Smax: 0.232
    • Smax_pos: 28
    • Smean: 0.113
    • D: 0.148
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446284648 NCBI
  • RefSeq: WP_000362503 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MDLDTITSISTPMGEGAIGIVRLSGPQAVEIADKLYKGKHLLNDVPSHTINYGHIIDPESKEVIEEVMVSVLRAPKTFTREDIIEINCHGGILTINRVLELTMTYGARMAEPGEFTKRAFLNGRIDLSQAEAVMDFIRSKTDRASKVAMNQIEGRLSDLIKKQRQSILEILAQVEVNIDYPEYDDVEDATTEFLLEQSKEIKQEINRLLDTGAQGKIMREGLSTVIVGKPNVGKSSMLNNLIQDNKAIVTEVAGTTRDVLEEYVNVRGVPLRLVDTAGIRETEDIVEKIGVERSRKALSQADLILFVLNNNEALTQEDYTLYEVVKNEDVIVIVNKMDLEQNIDINEVKDMIGDTPLIQTSMLKQEGIDELEIQIRDLFFGGEVQNQDMTYVSNSRHISLLKQARQTIQDAIDAAESGVPMDMVQIDLTRTWEILGEIIGETASDELIDQLFSQFCLGK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS14310 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 1.3 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]