From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01106
  • pan locus tag?: SAUPAN003390000
  • symbol: SAOUHSC_01106
  • pan gene symbol?: murI
  • synonym:
  • product: glutamate racemase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_01106
  • symbol: SAOUHSC_01106
  • product: glutamate racemase
  • replicon: chromosome
  • strand: +
  • coordinates: 1068153..1068953
  • length: 801
  • essential: yes [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGAATAAACCAATAGGTGTAATAGACTCTGGTGTCGGAGGTTTGACAGTAGCTAAAGAA
    ATTATGCGTCAGTTGCCAAATGAGACGATTTATTACTTAGGTGATATTGGACGATGTCCA
    TATGGGCCAAGACCAGGAGAACAAGTAAAACAATATACAGTTGAAATCGCTCGTAAATTA
    ATGGAATTTGATATAAAAATGCTCGTGATTGCTTGTAATACAGCAACTGCTGTAGCTTTA
    GAATATTTACAAAAGACCTTATCAATCCCAGTGATTGGCGTAATTGAACCAGGTGCTAGA
    ACAGCAATAATGACTACTAGAAATCAAAATGTATTAGTACTAGGAACGGAAGGCACAATT
    AAATCTGAAGCATATCGTACGCATATTAAACGTATCAATCCACATGTAGAGGTACATGGC
    GTTGCCTGTCCAGGTTTTGTGCCACTTGTAGAACAAATGAGATATAGTGATCCAACAATT
    ACAAGCATTGTCATTCATCAAACACTGAAACGTTGGCGTAATAGTGAGTCTGATACTGTC
    ATTTTAGGATGTACCCACTATCCATTGCTCTATAAACCTATCTATGATTATTTTGGTGGT
    AAAAAGACAGTGATTTCGTCTGGATTAGAAACGGCTCGTGAAGTTAGTGCATTGCTAACA
    TTTAGTAATGAACATGCAAGTTATACTGAACATCCAGATCATCGATTTTTTGCAACAGGT
    GATCCTACTCACATTACTAACATTATCAAAGAGTGGTTAAATTTATCTGTCAATGTGGAA
    CGTATATCAGTGAATGACTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    801

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_01106
  • symbol: SAOUHSC_01106
  • description: glutamate racemase
  • length: 266
  • theoretical pI: 7.63246
  • theoretical MW: 29698
  • GRAVY: -0.120301

Function[edit source | edit]

  • reaction:
    EC 5.1.1.3?  ExPASy
    Glutamate racemaseL-glutamate = D-glutamate
  • TIGRFAM:
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanglutamate racemase (TIGR00067; EC 5.1.1.3; HMM-score: 271.7)
    MetabolismEnergy metabolismAmino acids and aminesaspartate racemase (TIGR00035; EC 5.1.1.13; HMM-score: 51.1)
    Cellular processesCellular processesCell divisionseptum site-determining protein MinD (TIGR01968; HMM-score: 12.9)
  • TheSEED:  
    Amino Acids and DerivativesGlutamine, glutamate, aspartate, asparagine; ammonia assimilationGlutamine, Glutamate, Aspartate and Asparagine Biosynthesis Glutamate racemase (EC 5.1.1.3) 
    Cell Wall and CapsuleCell Wall and Capsule - no subcategoryPeptidoglycan Biosynthesis Glutamate racemase (EC 5.1.1.3) 
  • PFAM:
    Asp-glut_race (CL0399) Asp_Glu_race; Asp/Glu/Hydantoin racemase (PF01177; HMM-score: 117.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 0.83
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.104
    • Ymax_pos: 30
    • Cmax: 0.109
    • Cmax_pos: 21
    • Smax: 0.162
    • Smax_pos: 18
    • Smean: 0.089
    • D: 0.099
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNKPIGVIDSGVGGLTVAKEIMRQLPNETIYYLGDIGRCPYGPRPGEQVKQYTVEIARKLMEFDIKMLVIACNTATAVALEYLQKTLSIPVIGVIEPGARTAIMTTRNQNVLVLGTEGTIKSEAYRTHIKRINPHVEVHGVACPGFVPLVEQMRYSDPTITSIVIHQTLKRWRNSESDTVILGCTHYPLLYKPIYDYFGGKKTVISSGLETAREVSALLTFSNEHASYTEHPDHRFFATGDPTHITNIIKEWLNLSVNVERISVND

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]