From AureoWiki
Jump to: navigation, search

NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_02724
  • pan locus tag?: SAUPAN005981000
  • symbol: SAOUHSC_02724
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_02724
  • symbol: SAOUHSC_02724
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2504707..2505366
  • length: 660
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGAAAAGAACTGATAAATACCGTGATTCATATCAATACGACAATCAAAACCAAAATCAT
    CGTCGTCAATCTGAAGACGCATCGTATAGACAACAATATGCTAAAGGCGATCCTGAAGAA
    CACCCGGAACGATACTATAATGGTAGAGATTATCGAAGAGAACAAATTCTTGAAGAAGAA
    AACGAGAAATCCCGCCGTTCAAAAAAATGGTTATATATCATTATTGCCATTCTCTTAATT
    ATTGTCGCTATTTTTGTCACACGCGCCTTACTTAACAATGATAGCGATAAAGTTAGTAAT
    GACCCTAAAGTCTCTCAAAATTATAAAAAACAAGTTGAAAATCAAGACGGCCAAATTAAC
    CAGCAAGTAGATAATGCTAAAGAAAATATTAAAAACAACCAAAAAACTGATGACATTATT
    AAAAATTTACAAAATCAAATCGACAACTTGAAGCAGCAAGAACAAAACAAAGCTGATTCT
    AAGCTAACTCAATTTTATCAAGACCAAATCAACAAATTGACAGAGGCAAATAATGCACTT
    AAAAACAATGCAAGCCAAGGTAAAATTGAAAGCATGTTAAATGATATTAATACAAAATTC
    GACAGTATTAAATCTAAATTAGAAAGCTTATTTAAAGATGACAATGGTGGCGCTAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_02724
  • symbol: SAOUHSC_02724
  • description: hypothetical protein
  • length: 219
  • theoretical pI: 8.61585
  • theoretical MW: 25799.2
  • GRAVY: -1.38402

Function[edit source | edit]

  • TIGRFAM:
    TIGR03943 family protein (TIGR03943; HMM-score: 15.1)
    Genetic information processingProtein fateProtein folding and stabilizationcytochrome c-type biogenesis protein CcmI (TIGR03142; HMM-score: 14.6)
    MetabolismEnergy metabolismElectron transportcytochrome c-type biogenesis protein CcmI (TIGR03142; HMM-score: 14.6)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsPTS system, glucose-specific IIBC component (TIGR02002; EC 2.7.1.69; HMM-score: 13.7)
    and 11 more
    Cellular processesCellular processesPathogenesistype IV/VI secretion system protein, DotU family (TIGR03349; HMM-score: 11.6)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype IV/VI secretion system protein, DotU family (TIGR03349; HMM-score: 11.6)
    Cellular processesCellular processesToxin production and resistancethiopeptide-type bacteriocin biosynthesis domain (TIGR03891; HMM-score: 11.1)
    Hypothetical proteinsConservedTIGR00366 family protein (TIGR00366; HMM-score: 10.5)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsD-galactonate transporter (TIGR00893; HMM-score: 10)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherC-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 10)
    conjugal transfer/type IV secretion protein DotA/TraY (TIGR04346; HMM-score: 9.1)
    phage lysis regulatory protein, LysB family (TIGR03495; HMM-score: 5.6)
    two transmembrane protein (TIGR04527; HMM-score: 4.7)
    Cellular processesCellular processesPathogenesistype III secretion apparatus protein, YscR/HrcR family (TIGR01102; HMM-score: 4)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype III secretion apparatus protein, YscR/HrcR family (TIGR01102; HMM-score: 4)
  • TheSEED:  
    FIG01107902: hypothetical protein 
  • PFAM:
    no clan definedDUF1510; Protein of unknown function (DUF1510) (PF07423; HMM-score: 26.3)
    and 28 more
    FRB_dom; FKBP12-rapamycin binding domain (PF08771; HMM-score: 20)
    Med9; RNA polymerase II transcription mediator complex subunit 9 (PF07544; HMM-score: 18.3)
    Peptidase_MA (CL0126) DUF3810; Protein of unknown function (DUF3810) (PF12725; HMM-score: 17.5)
    no clan definedGlutR_dimer; Glutamyl-tRNAGlu reductase, dimerisation domain (PF00745; HMM-score: 17.3)
    Amnionless; Amnionless (PF14828; HMM-score: 16.9)
    ATP_synthase (CL0255) ATP-synt_B; ATP synthase B/B' CF(0) (PF00430; HMM-score: 16.3)
    no clan definedSNARE; SNARE domain (PF05739; HMM-score: 16.2)
    DUF4094; Domain of unknown function (DUF4094) (PF13334; HMM-score: 16.2)
    DUF2408; Protein of unknown function (DUF2408) (PF10303; HMM-score: 14.3)
    DUF4446; Protein of unknown function (DUF4446) (PF14584; HMM-score: 14.2)
    MFS (CL0015) MFS_Mycoplasma; Mycoplasma MFS transporter (PF07672; HMM-score: 14.1)
    ABC-2 (CL0181) ABC2_membrane_3; ABC-2 family transporter protein (PF12698; HMM-score: 14)
    no clan definedDUF948; Bacterial protein of unknown function (DUF948) (PF06103; HMM-score: 13.7)
    ATP_synthase (CL0255) HrpE; HrpE/YscL/FliH and V-type ATPase subunit E (PF06188; HMM-score: 12.5)
    PepSY_TM-like (CL0490) PepSY_TM_like_2; Putative PepSY_TM-like (PF16357; HMM-score: 12.5)
    no clan definedSARAF; SOCE-associated regulatory factor of calcium homoeostasis (PF06682; HMM-score: 12.2)
    ABC-2 (CL0181) ABC2_membrane_2; ABC-2 family transporter protein (PF12679; HMM-score: 11.7)
    Zn_Beta_Ribbon (CL0167) DUF2116; Uncharacterized protein containing a Zn-ribbon (DUF2116) (PF09889; HMM-score: 11.6)
    GPCR_A (CL0192) SID-1_RNA_chan; dsRNA-gated channel SID-1 (PF13965; HMM-score: 11.5)
    IT (CL0182) SCFA_trans; Short chain fatty acid transporter (PF02667; HMM-score: 10.5)
    no clan definedYtxH; YtxH-like protein (PF12732; HMM-score: 10.1)
    FUN14; FUN14 family (PF04930; HMM-score: 9.7)
    SapB_1; Saposin-like type B, region 1 (PF05184; HMM-score: 8.9)
    DUF5469; Family of unknown function (DUF5469) (PF17561; HMM-score: 8.3)
    PP2C_C; Protein serine/threonine phosphatase 2C, C-terminal domain (PF07830; HMM-score: 7.3)
    DUF3899; Domain of unknown function (DUF3899) (PF13038; HMM-score: 7.2)
    Not1; CCR4-Not complex component, Not1 (PF04054; HMM-score: 7.1)
    Vma12; Endoplasmic reticulum-based factor for assembly of V-ATPase (PF11712; HMM-score: 6.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helix: 1
  • LocateP: Intracellular /TMH start AFTER 60
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: Possibly Sec-
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.111
    • Ymax_pos: 69
    • Cmax: 0.117
    • Cmax_pos: 37
    • Smax: 0.165
    • Smax_pos: 2
    • Smean: 0.111
    • D: 0.111
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKRTDKYRDSYQYDNQNQNHRRQSEDASYRQQYAKGDPEEHPERYYNGRDYRREQILEEENEKSRRSKKWLYIIIAILLIIVAIFVTRALLNNDSDKVSNDPKVSQNYKKQVENQDGQINQQVDNAKENIKNNQKTDDIIKNLQNQIDNLKQQEQNKADSKLTQFYQDQINKLTEANNALKNNASQGKIESMLNDINTKFDSIKSKLESLFKDDNGGAN

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]