NCBI: 10-JUN-2013

⊟Summary

• organism: Staphylococcus aureus USA300_FPR3757
• locus tag: SAUSA300_0777 [new locus tag: SAUSA300_RS04190 ]
• pan locus tag^?: SAUPAN002802000
• symbol: SAUSA300_0777
• pan gene symbol^?: cspC
• synonym:
• product: cold shock protein

⊟Gene

⊟General

• type: CDS
• locus tag: SAUSA300_0777 [new locus tag: SAUSA300_RS04190 ]
• symbol: SAUSA300_0777
• product: cold shock protein
• replicon: chromosome
• strand: +
• coordinates: 867258..867458
• length: 201
• essential: unknown other strains

⊟Accession numbers

• Gene ID: 3914809 NCBI
• RefSeq: YP_493477 NCBI
• BioCyc: GH3C-772 BioCyc
• MicrobesOnline: 1292292 MicrobesOnline

⊟Phenotype

Share your knowledge and add information here. [edit]

⊟DNA sequence

• 1
  61
  121
  181
  
  ATGAATAACGGTACAGTTAAATGGTTTAATGCAGAAAAAGGTTTTGGTTTCATCGAAAGA
  GAAGATGGTAGCGACGTATTCGTACACTTCTCAGCAATCGCTGAAGATGGATACAAATCA
  TTAGAAGAAGGCCAAAAAGTTGAATTCGACATCGTTGAAGGCGACCGTGGCGAGCAAGCT
  GCAAACGTAGTTAAAATGTAA
  60
  120
  180
  201
  

⊟Protein

⊟General

• locus tag: SAUSA300_0777 [new locus tag: SAUSA300_RS04190 ]
• symbol: SAUSA300_0777
• description: cold shock protein
• length: 66
• theoretical pI: 4.18132
• theoretical MW: 7374.06
• GRAVY: -0.513636

⊟Function

• TIGRFAM:
  Cellular processesCellular processesAdaptations to atypical conditionscold shock domain protein CspD (TIGR02381; HMM-score: 91.9)
  Genetic information processingDNA metabolismDNA replication, recombination, and repaircold shock domain protein CspD (TIGR02381; HMM-score: 91.9)
  and 1 more
  Genetic information processingTranscriptionDegradation of RNAVacB and RNase II family 3'-5' exoribonucleases (TIGR00358; EC 3.1.13.1; HMM-score: 12.1)
• TheSEED:  
  Stress ResponseCold shockCold shock, CspA family of proteins Cold shock protein CspC
• PFAM:
  OB (CL0021) CSD; 'Cold-shock' DNA-binding domain (PF00313; HMM-score: 108.8)
  and 2 more
  S1; S1 RNA binding domain (PF00575; HMM-score: 18)
  OB_RNB; Ribonuclease B OB domain (PF08206; HMM-score: 15.8)

⊟Structure, modifications & interactions

• domains:
• modifications:
• cofactors:
• effectors:
• protein partners:

⊟Localization

• PSORTb: Cytoplasmic
  • Cytoplasmic Score: 9.97
  • Cytoplasmic Membrane Score: 0
  • Cellwall Score: 0.01
  • Extracellular Score: 0.02
  • Internal Helices: 0
• LocateP: Intracellular
  • Prediction by SwissProt Classification: Cytoplasmic
  • Pathway Prediction: No pathway
  • Intracellular Possibility: 1
  • Signal Peptide Possibility: -1
  • N-terminally Anchored Score: -1
  • Predicted Cleavage Site: No CleavageSite
• SignalP: no predicted signal peptide
  • Ymax: 0.099
  • Ymax_pos: 61
  • Cmax: 0.116
  • Cmax_pos: 35
  • Smax: 0.127
  • Smax_pos: 2
  • Smean: 0.073
  • D: 0.089
• predicted transmembrane helices (TMHMM): 0

⊟Accession numbers

• GI: 87161313 NCBI
• RefSeq: YP_493477 NCBI
• UniProt: A0A0H2XII8 UniProt

⊟Protein sequence

• MNNGTVKWFNAEKGFGFIEREDGSDVFVHFSAIAEDGYKSLEEGQKVEFDIVEGDRGEQAANVVKM

⊟Experimental data

• experimentally validated: no data available

⊟Expression & Regulation

⊟Operon

• MicrobesOnline: SAUSA300_0777 no polycistronic organisation predicted

⊟Regulation

• regulator:

⊟Transcription pattern

• S.aureus Expression Data Browser: data available for NCTC8325

⊟Protein synthesis (provided by Aureolib)

• Aureolib: no data available

⊟Protein stability

• half-life: no data available

⊟Other Information

You are kindly invited to share additional interesting facts.