From AureoWiki
Jump to: navigation, search
Pangenome04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40

NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_1437 [new locus tag: SAUSA300_RS07850 ]
  • pan locus tag?: SAUPAN001319000
  • symbol: SAUSA300_1437
  • pan gene symbol?:
  • synonym:
  • product: phiSLT ORF204-like protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_1437 [new locus tag: SAUSA300_RS07850 ]
  • symbol: SAUSA300_1437
  • product: phiSLT ORF204-like protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1589993..1590607
  • length: 615
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGACTCAATTTCTAGGGGCGCTTCTTCTTACAGGAGTTTTAGGTTACATACCATATAAA
    TATCTAACAATGATAGGTTTAGTTAGTGAAAAAAACAAGGTTATCAATACTCCTGTATTA
    TTGATTTTTTCTATTGAAACATGTTTGATATGGTTTTATAGTTTTATAATTTTTAATAAT
    GTTGATTTAAAAAATTTGAATTTAATTCAGTTGCTTACAGGTCTAAAAGCAAATATTTTG
    TTTCTATTTATTTTTGTTTTAACAGTGTTTGTATTTAATCCTTTAATTGTTAAATTTATT
    ATCTGGTTAATTAATATAACCAGAAAGTTTATGAAATTGGATTGTATAAGCTTATTAGAC
    AAAAGAGACAAGTTGTTTAATAACAACGGTAAACCAGTATTTATAGTTATAAAAGACTTT
    GAAAACAGAATCATTGAAGAGGGTGAACTTAAAACCTATAATTCAGCTGGTAGCGATTTC
    GATTTACTAGAAGTTGAGCGACAAGATTTCAAAGTATCTGATTTACCGTCAAACGATGAA
    TTGTATATTAAACATACGCTTGTAGACCTTAAACAACAAATTAAATTGGATTTATATTTA
    ATGAATGAATACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    615

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_1437 [new locus tag: SAUSA300_RS07850 ]
  • symbol: SAUSA300_1437
  • description: phiSLT ORF204-like protein
  • length: 204
  • theoretical pI: 5.9717
  • theoretical MW: 23822.1
  • GRAVY: 0.422059

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:  
    FIG081523: hypothetical protein within a prophage 
  • PFAM:

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 3
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0
    • Signal Peptide Possibility: -0.5
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.106
    • Ymax_pos: 11
    • Cmax: 0.115
    • Cmax_pos: 31
    • Smax: 0.18
    • Smax_pos: 1
    • Smean: 0.095
    • D: 0.102
  • predicted transmembrane helices (TMHMM): 3

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTQFLGALLLTGVLGYIPYKYLTMIGLVSEKNKVINTPVLLIFSIETCLIWFYSFIIFNNVDLKNLNLIQLLTGLKANILFLFIFVLTVFVFNPLIVKFIIWLINITRKFMKLDCISLLDKRDKLFNNNGKPVFIVIKDFENRIIEEGELKTYNSAGSDFDLLEVERQDFKVSDLPSNDELYIKHTLVDLKQQIKLDLYLMNEY

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SAUSA300_1437 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]