From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_1470 [new locus tag: SAUSA300_RS08025 ]
  • pan locus tag?: SAUPAN004076000
  • symbol: SAUSA300_1470
  • pan gene symbol?: ispA
  • synonym:
  • product: geranyltranstransferase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_1470 [new locus tag: SAUSA300_RS08025 ]
  • symbol: SAUSA300_1470
  • product: geranyltranstransferase
  • replicon: chromosome
  • strand: -
  • coordinates: 1625506..1626387
  • length: 882
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGACGAATCTACCGATGAATAAATTAATAGATGAAGTCAATAATGAATTATCGGTTGCG
    ATAAATAAATCAGTAATGGATACTCAGCTAGAAGAAAGTATGTTGTATTCATTAAATGCT
    GGAGGTAAACGCATCCGACCAGTTCTGTTATTACTCACTTTAGATTCACTAAATACCGAG
    TATGAGTTAGGTATGAAGAGCGCAATTGCACTAGAAATGATTCATACATATTCACTTATT
    CATGATGACCTACCAGCGATGGATAATGATGATTATCGACGAGGAAAATTAACAAATCAT
    AAAGTATATGGTGAGTGGACTGCGATATTAGCAGGTGATGCTTTATTAACTAAAGCATTT
    GAACTTATTTCAAGTGATGATAGATTAACTGATGAAGTAAAAATAAAAGTTCTACAACGG
    CTGTCAATAGCAAGTGGTCATGTTGGAATGGTCGGCGGTCAAATGTTAGATATGCAAAGC
    GAAGGCCAACCAATTGATCTTGAAACTTTGGAAATGATACACAAAACAAAAACAGGAGCA
    TTATTAACTTTTGCGGTTATGAGTGCAGCAGATATCGCTAATGTCGATGATACAACTAAA
    GAACATTTAGAAAGTTATAGTTATCATTTAGGTATGATGTTCCAGATTAAAGATGATTTA
    TTAGACTGCTATGGTGATGAAGCAAAGTTAGGTAAAAAAGTGGGCAGCGATCTTGAAAAT
    AATAAAAGTACGTACGTGAGTTTATTAGGGAAAGATGGCGCAGAAGATAAATTGACTTAT
    CATAGAGACGCAGCAGTGGATGAACTAACGCAAATTGATGAACAATTCAATACAAAACAC
    TTATTAGAAATCGTTGATTTATTTTATAGCAGGGATCACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    882

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_1470 [new locus tag: SAUSA300_RS08025 ]
  • symbol: SAUSA300_1470
  • description: geranyltranstransferase
  • length: 293
  • theoretical pI: 4.49116
  • theoretical MW: 32808.1
  • GRAVY: -0.272696

Function[edit source | edit]

  • reaction:
    EC 2.5.1.10?  ExPASy
    (2E,6E)-farnesyl diphosphate synthaseGeranyl diphosphate + isopentenyl diphosphate = diphosphate + (2E,6E)-farnesyl diphosphate
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneheptaprenyl diphosphate synthase component II (TIGR02748; EC 2.5.1.30; HMM-score: 119.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinonesolanesyl diphosphate synthase (TIGR02749; EC 2.5.1.-; HMM-score: 104.5)
  • TheSEED:  
    Archaeal lipids Octaprenyl diphosphate synthase (EC 2.5.1.90) / Dimethylallyltransferase (EC 2.5.1.1) / (2E,6E)-farnesyl diphosphate synthase (EC 2.5.1.10) / Geranylgeranyl pyrophosphate synthetase (EC 2.5.1.29) 
    Carotenoids Octaprenyl diphosphate synthase (EC 2.5.1.90) / Dimethylallyltransferase (EC 2.5.1.1) / (2E,6E)-farnesyl diphosphate synthase (EC 2.5.1.10) / Geranylgeranyl pyrophosphate synthetase (EC 2.5.1.29) 
    Isoprenoid Biosynthesis Octaprenyl diphosphate synthase (EC 2.5.1.90) / Dimethylallyltransferase (EC 2.5.1.1) / (2E,6E)-farnesyl diphosphate synthase (EC 2.5.1.10) / Geranylgeranyl pyrophosphate synthetase (EC 2.5.1.29) 
    Isoprenoid Biosynthesis: Interconversions Octaprenyl diphosphate synthase (EC 2.5.1.90) / Dimethylallyltransferase (EC 2.5.1.1) / (2E,6E)-farnesyl diphosphate synthase (EC 2.5.1.10) / Geranylgeranyl pyrophosphate synthetase (EC 2.5.1.29) 
    Isoprenoinds for Quinones Octaprenyl diphosphate synthase (EC 2.5.1.90) / Dimethylallyltransferase (EC 2.5.1.1) / (2E,6E)-farnesyl diphosphate synthase (EC 2.5.1.10) / Geranylgeranyl pyrophosphate synthetase (EC 2.5.1.29) 
    Polyprenyl Diphosphate Biosynthesis Octaprenyl diphosphate synthase (EC 2.5.1.90) / Dimethylallyltransferase (EC 2.5.1.1) / (2E,6E)-farnesyl diphosphate synthase (EC 2.5.1.10) / Geranylgeranyl pyrophosphate synthetase (EC 2.5.1.29) 
  • PFAM:
    Terp_synthase (CL0613) polyprenyl_synt; Polyprenyl synthetase (PF00348; HMM-score: 188.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.131
    • Ymax_pos: 21
    • Cmax: 0.112
    • Cmax_pos: 21
    • Smax: 0.211
    • Smax_pos: 8
    • Smean: 0.15
    • D: 0.139
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTNLPMNKLIDEVNNELSVAINKSVMDTQLEESMLYSLNAGGKRIRPVLLLLTLDSLNTEYELGMKSAIALEMIHTYSLIHDDLPAMDNDDYRRGKLTNHKVYGEWTAILAGDALLTKAFELISSDDRLTDEVKIKVLQRLSIASGHVGMVGGQMLDMQSEGQPIDLETLEMIHKTKTGALLTFAVMSAADIANVDDTTKEHLESYSYHLGMMFQIKDDLLDCYGDEAKLGKKVGSDLENNKSTYVSLLGKDGAEDKLTYHRDAAVDELTQIDEQFNTKHLLEIVDLFYSRDH

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]