From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_2156 [new locus tag: SAUSA300_RS11875 ]
  • pan locus tag?: SAUPAN005594000
  • symbol: SAUSA300_2156
  • pan gene symbol?: lacR
  • synonym:
  • product: lactose phosphotransferase system repressor

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_2156 [new locus tag: SAUSA300_RS11875 ]
  • symbol: SAUSA300_2156
  • product: lactose phosphotransferase system repressor
  • replicon: chromosome
  • strand: -
  • coordinates: 2333108..2333863
  • length: 756
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    TTGAATAAACATGAACGTTTGGACGAAATTGCTAAACTAGTGAATAAAAAGGGCACGATA
    AGAACGAATGAAATCGTCGAAGGTTTAAATGTGTCTGATATGACAGTTCGAAGAGATTTA
    ATTGAATTGGAAAATAAAGGGATTTTAACGAAGATTCATGGTGGTGCACGCAGTAATTCA
    ACATTTCAGTATAAAGAAATATCGCATAAAGAAAAACATACCCGTCAAATTGCAGAAAAA
    CGATTTATAGCTAAAAAAGCTGCATCATTAATTGAAGATGGGGATACTTTGTTTTTCGGA
    CCAGGAACAACAGTGGAACTATTAGCAGAAGAAGTCAATCATCATACGCTCACAATTATT
    ACGAATTGTTTGCCGGTGTATAAAATTTTGTTAGAAAAACAAACAGCACATTTTCGTGTC
    TATTTAATTGGTGGTGAAATGCGCCATATTACAGAAGCATTTGTAGGTGAAATGGCGAAC
    GCCATGTTGGAAAAACTAAGATTTAGCAAGATGTTCTTTAGTAGTAACGCAGTAAATAAA
    GGTGCTGTGATGACATCTACATTAGATGAAGCCTATACGCAACAACTGGCACTAAGTAAT
    TCAATTGAAAAATACTTGTTAATCGATCATACGAAAGTTGGCAAAGAAGATTTTACATCA
    TTTTGTCAGTTAAACGAATTGACTGCAGTGGTCATGGACTATGAAGATGAAGAAAAAGTA
    GAAACGATTAAAACATATATTGAAGTAGTCGACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    756

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_2156 [new locus tag: SAUSA300_RS11875 ]
  • symbol: SAUSA300_2156
  • description: lactose phosphotransferase system repressor
  • length: 251
  • theoretical pI: 6.24703
  • theoretical MW: 28548.6
  • GRAVY: -0.293626

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Signal transductionRegulatory functionsDNA interactionsCRISPR locus-related DNA-binding protein (TIGR01884; HMM-score: 23.8)
    MetabolismEnergy metabolismAmino acids and amineshistidine utilization repressor (TIGR02018; HMM-score: 15.8)
    Signal transductionRegulatory functionsDNA interactionshistidine utilization repressor (TIGR02018; HMM-score: 15.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtheriron-sulfur cluster biosynthesis transcriptional regulator SufR (TIGR02702; HMM-score: 14.7)
    Signal transductionRegulatory functionsDNA interactionsiron-sulfur cluster biosynthesis transcriptional regulator SufR (TIGR02702; HMM-score: 14.7)
  • TheSEED:  
    CarbohydratesDi- and oligosaccharidesLactose and Galactose Uptake and Utilization Lactose phosphotransferase system repressor 
  • PFAM:
    ISOCOT_Fold (CL0246) DeoRC; DeoR C terminal sensor domain (PF00455; HMM-score: 162.3)
    HTH (CL0123) HTH_DeoR; DeoR-like helix-turn-helix domain (PF08220; HMM-score: 81)
    HTH_11; HTH domain (PF08279; HMM-score: 27.5)
    GntR; Bacterial regulatory proteins, gntR family (PF00392; HMM-score: 21.3)
    FaeA; FaeA-like protein (PF04703; HMM-score: 17.6)
    TrmB; Sugar-specific transcriptional regulator TrmB (PF01978; HMM-score: 16.3)
    Fe_dep_repress; Iron dependent repressor, N-terminal DNA binding domain (PF01325; HMM-score: 14.8)
    Penicillinase_R; Penicillinase repressor (PF03965; HMM-score: 14)
    ISOCOT_Fold (CL0246) CoA_trans; Coenzyme A transferase (PF01144; HMM-score: 12.6)
    HTH (CL0123) Rrf2; Transcriptional regulator (PF02082; HMM-score: 12.6)
    PaaX; PaaX-like protein (PF07848; HMM-score: 12.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.138
    • Ymax_pos: 11
    • Cmax: 0.103
    • Cmax_pos: 55
    • Smax: 0.259
    • Smax_pos: 5
    • Smean: 0.192
    • D: 0.159
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNKHERLDEIAKLVNKKGTIRTNEIVEGLNVSDMTVRRDLIELENKGILTKIHGGARSNSTFQYKEISHKEKHTRQIAEKRFIAKKAASLIEDGDTLFFGPGTTVELLAEEVNHHTLTIITNCLPVYKILLEKQTAHFRVYLIGGEMRHITEAFVGEMANAMLEKLRFSKMFFSSNAVNKGAVMTSTLDEAYTQQLALSNSIEKYLLIDHTKVGKEDFTSFCQLNELTAVVMDYEDEEKVETIKTYIEVVD

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]