From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS00825 [old locus tag: SAUSA300_0156 ]
  • pan locus tag?: SAUPAN000979000
  • symbol: SAUSA300_RS00825
  • pan gene symbol?: capE
  • synonym:
  • product: UDP-glucose 4-epimerase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_RS00825 [old locus tag: SAUSA300_0156 ]
  • symbol: SAUSA300_RS00825
  • product: UDP-glucose 4-epimerase
  • replicon: chromosome
  • strand: +
  • coordinates: 178132..179160
  • length: 1029
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_007793 (178132..179160) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    ATGTTCGATGACAAAATTTTATTAATTACTGGGGGCACAGGATCATTCGGTAATGCTGTT
    ATGAAACAGTTTTTAGATTCTAATATTAAAGAAATTCGTATTTTTTCACGCGATGAGAAA
    AAACAAGATGACATTCGAAAAAAATATAATAATTCAAAATTAAAGTTCTACATTGGTGAT
    GTGCGTGATAGTCAAAGTGTAGAAACAGCAATGCGAGATGTTTATTACGTATTCCATGCA
    GCAGCTTTAAAACAAGTGCCGTCATGTGAATTCTTTCCAGTTGAGGCAGTGAAGACAAAT
    ATTATTGGTACAGAAAATGTCTTACAAAGTGCTATTCATCAAAATGTTAAAAAAGTCATA
    TGTTTATCTACAGATAAGGCAGCGTATCCTATTAATGCTATGGGTATTTCAAAAGCAATG
    ATGGAAAAAGTATTCGTAGCCAAATCAAGAAATATTCGTAGTGAACAAACGCTTATTTGT
    GGTACAAGATACGGTAATGTGATGGCTTCAAGAGGATCAGTAATACCTTTGTTTATCGAC
    AAAATCAAAGCTGGAGAACCTTTAACGATTACAGATCCTGATATGACAAGATTTTTAATG
    AGCTTAGAAGATGCGGTAGAACTAGTTGTTCATGCATTTAAGCATGCAGAGACAGGAGAT
    ATTATGGTTCAAAAAGCACCAAGCTCAACGGTAGGGGATCTTGCGACCGCATTATTAGAA
    TTGTTTGAAGCTGATAATGCAATTGAAATCATTGGTACGCGACATGGAGAGAAAAAAGCA
    GAAACATTGTTGACGAGAGAAGAATACGCACAATGTGAAGATATGGGTGATTATTTTAGA
    GTGCCGGCAGACTCCAGAGATTTAAATTATAGTAATTATGTTGAAACCGGTAACGAAAAG
    ATTACGCAATCTTATGAATATAACTCCGATAATACACATATTTTAACGGTGGAAGAGATA
    AAAGAAAAACTTTTAACACTAGAATATGTTAGAAACGAATTGAATGATTATAAAGCTTCA
    ATGAGATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1029

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_RS00825 [old locus tag: SAUSA300_0156 ]
  • symbol: SAUSA300_RS00825
  • description: UDP-glucose 4-epimerase
  • length: 342
  • theoretical pI: 5.33257
  • theoretical MW: 38614.8
  • GRAVY: -0.32807

Function[edit source | edit]

  • reaction:
    EC 5.1.3.-?  ExPASy
    EC 4.2.1.-?  ExPASy
  • TIGRFAM:
    UDP-N-acetylglucosamine 4,6-dehydratase/5-epimerase (TIGR04130; EC 4.2.1.-,5.1.3.-; HMM-score: 552.8)
    UDP-N-acetylglucosamine 4,6-dehydratase (inverting) (TIGR03589; EC 4.2.1.115; HMM-score: 332.4)
    NAD dependent epimerase/dehydratase, LLPSF_EDH_00030 family (TIGR04180; HMM-score: 67.5)
    hopanoid-associated sugar epimerase (TIGR03466; HMM-score: 51.2)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesCDP-glucose 4,6-dehydratase (TIGR02622; EC 4.2.1.45; HMM-score: 49.4)
    MetabolismEnergy metabolismSugarsUDP-glucose 4-epimerase GalE (TIGR01179; EC 5.1.3.2; HMM-score: 45.9)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesdTDP-glucose 4,6-dehydratase (TIGR01181; EC 4.2.1.46; HMM-score: 44.1)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesADP-glyceromanno-heptose 6-epimerase (TIGR02197; EC 5.1.3.20; HMM-score: 40.2)
    Hypothetical proteinsConservedTIGR01777 family protein (TIGR01777; HMM-score: 25.6)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesdTDP-4-dehydrorhamnose reductase (TIGR01214; EC 1.1.1.133; HMM-score: 24.3)
    acetoacetyl-CoA reductase (TIGR01829; EC 1.1.1.36; HMM-score: 16.6)
    MetabolismFatty acid and phospholipid metabolismBiosynthesis3-oxoacyl-[acyl-carrier-protein] reductase (TIGR01830; EC 1.1.1.100; HMM-score: 16.4)
    cis-2,3-dihydrobiphenyl-2,3-diol dehydrogenase (TIGR03325; EC 1.3.1.56; HMM-score: 15.8)
    CRISPR-associated protein Cas7/Csp1, subtype PGING (TIGR03489; HMM-score: 14.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminglutamyl-tRNA reductase (TIGR01035; EC 1.2.1.70; HMM-score: 13.6)
    2-hydroxycyclohexanecarboxyl-CoA dehydrogenase (TIGR03206; EC 1.1.1.-; HMM-score: 12.6)
    2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (TIGR04316; EC 1.3.1.28; HMM-score: 12.5)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) Polysacc_synt_2; Polysaccharide biosynthesis protein (PF02719; HMM-score: 351.6)
    Epimerase; NAD dependent epimerase/dehydratase family (PF01370; HMM-score: 87.4)
    Polysacc_syn_2C; Polysaccharide biosynthesis protein C-terminal (PF08485; HMM-score: 73)
    3Beta_HSD; 3-beta hydroxysteroid dehydrogenase/isomerase family (PF01073; HMM-score: 71.9)
    GDP_Man_Dehyd; GDP-mannose 4,6 dehydratase (PF16363; HMM-score: 68.7)
    NAD_binding_10; NAD(P)H-binding (PF13460; HMM-score: 45.1)
    RmlD_sub_bind; RmlD substrate binding domain (PF04321; HMM-score: 33)
    NmrA; NmrA-like family (PF05368; HMM-score: 27.3)
    NAD_binding_4; Male sterility protein (PF07993; HMM-score: 25.7)
    F420_oxidored; NADP oxidoreductase coenzyme F420-dependent (PF03807; HMM-score: 25.3)
    KR; KR domain (PF08659; HMM-score: 24.6)
    adh_short; short chain dehydrogenase (PF00106; HMM-score: 22.4)
    NAD_Gly3P_dh_N; NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus (PF01210; HMM-score: 19.8)
    Shikimate_DH; Shikimate / quinate 5-dehydrogenase (PF01488; HMM-score: 19.4)
    Sacchrp_dh_NADP; Saccharopine dehydrogenase NADP binding domain (PF03435; HMM-score: 18.6)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 15.5)
    no clan definedArfGap; Putative GTPase activating protein for Arf (PF01412; HMM-score: 11.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.137
    • Ymax_pos: 23
    • Cmax: 0.145
    • Cmax_pos: 23
    • Smax: 0.183
    • Smax_pos: 17
    • Smean: 0.124
    • D: 0.132
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446381202 NCBI
  • RefSeq: WP_000459057 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MFDDKILLITGGTGSFGNAVMKQFLDSNIKEIRIFSRDEKKQDDIRKKYNNSKLKFYIGDVRDSQSVETAMRDVYYVFHAAALKQVPSCEFFPVEAVKTNIIGTENVLQSAIHQNVKKVICLSTDKAAYPINAMGISKAMMEKVFVAKSRNIRSEQTLICGTRYGNVMASRGSVIPLFIDKIKAGEPLTITDPDMTRFLMSLEDAVELVVHAFKHAETGDIMVQKAPSSTVGDLATALLELFEADNAIEIIGTRHGEKKAETLLTREEYAQCEDMGDYFRVPADSRDLNYSNYVETGNEKITQSYEYNSDNTHILTVEEIKEKLLTLEYVRNELNDYKASMR

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SAUSA300_RS00825 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]