Due to technical reasons this service will not be available for 7 days from 27 Nov to 04 Dec 2017
From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS08380 [old locus tag: SAUSA300_1537 ]
  • pan locus tag?: SAUPAN004160000
  • symbol: SAUSA300_RS08380
  • pan gene symbol?: rsmE
  • synonym:
  • product: 16S rRNA (uracil(1498)-N(3))-methyltransferase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_RS08380 [old locus tag: SAUSA300_1537 ]
  • symbol: SAUSA300_RS08380
  • product: 16S rRNA (uracil(1498)-N(3))-methyltransferase
  • replicon: chromosome
  • strand: -
  • coordinates: 1686440..1687192
  • length: 753
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_007793 (1686440..1687192) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    GTGCAACGTTATTTCATAGACCAAAACGCTGATGTAAGTCAGCGTTTTTTTATTACAAAA
    AAAGAAGATATTCATCATATAACAAATGTAATGAGATATGATGTTGGTAGTAAAATTATT
    TTAACTTTTAATGATCAAACAGTTTATTTATGTGAAATTGCTGACATAACAAGTGATAAA
    ATTGAAGTTGATTTAAAAGAAAAACAAAATATTAATACAGAATTGCCAGTTGATGTTACG
    ATTTGCAGTGGACTAATCAAAGCTGACAAATATGAGTGGTTGCTACAAAAAGCTACTGAA
    TTGGGTGCTTCATCATTTATAGCTGTGAGCATGGAACGTTCAATTGTTAAATTAAACGAG
    GCAAAAGTTGCCAAAAAGATAGAGCGTTGGCAAAAAATAATTAAAGAAGCTGCTGAACAA
    AGCTATCGTTTAGTGATTCCATCTATTCAATTCGAGTCGAATTTAAAATTAATTTGTGAT
    ACTATTGATAATTATGACTATATTCTTATTGCATATGAAGAGGAAGCAAAAGATGGTGAG
    TTAAGCAATTTCAAGCAAACTTTACAACAATTCAATGCTCAGGATAAAGTGTTGATGATT
    TTTGGTCCTGAGGGTGGTTTGTCAGAAAATGAAATTTCATTATTTAGTAATACTAGTACA
    GTTGTTGGTCTTGGGCCGAGAATTTTACGGGCAGAAACTGCGCCATTGTATGCGTTAAGT
    GCAATAAGTTATGAAAAAGAATTAATGGGGTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    753

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_RS08380 [old locus tag: SAUSA300_1537 ]
  • symbol: SAUSA300_RS08380
  • description: 16S rRNA (uracil(1498)-N(3))-methyltransferase
  • length: 250
  • theoretical pI: 4.60587
  • theoretical MW: 28469.4
  • GRAVY: -0.1916

Function[edit source | edit]

  • reaction:
    EC 2.1.1.193?  ExPASy
    16S rRNA (uracil1498-N3)-methyltransferaseS-adenosyl-L-methionine + uracil1498 in 16S rRNA = S-adenosyl-L-homocysteine + N3-methyluracil1498 in 16S rRNA
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA and rRNA base modificationRNA methyltransferase, RsmE family (TIGR00046; EC 2.1.1.-; HMM-score: 204.7)
  • TheSEED:
  • PFAM:
    SPOUT (CL0098) Methyltrans_RNA; RNA methyltransferase (PF04452; HMM-score: 247.9)
    SpoU_methylase; SpoU rRNA Methylase family (PF00588; HMM-score: 16.1)
    bBprotInhib (CL0354) Staphostatin_A; Staphostatin A (PF09022; HMM-score: 11.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.103
    • Ymax_pos: 70
    • Cmax: 0.11
    • Cmax_pos: 51
    • Smax: 0.121
    • Smax_pos: 64
    • Smean: 0.085
    • D: 0.096
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 447112872 NCBI
  • RefSeq: WP_001190128 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MQRYFIDQNADVSQRFFITKKEDIHHITNVMRYDVGSKIILTFNDQTVYLCEIADITSDKIEVDLKEKQNINTELPVDVTICSGLIKADKYEWLLQKATELGASSFIAVSMERSIVKLNEAKVAKKIERWQKIIKEAAEQSYRLVIPSIQFESNLKLICDTIDNYDYILIAYEEEAKDGELSNFKQTLQQFNAQDKVLMIFGPEGGLSENEISLFSNTSTVVGLGPRILRAETAPLYALSAISYEKELMG

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SAUSA300_RS08380 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]