Due to technical reasons this service will not be available for 7 days from 27 Nov to 04 Dec 2017
From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS12265 [old locus tag: SAUSA300_2220 ]
  • pan locus tag?: SAUPAN005730000
  • symbol: SAUSA300_RS12265
  • pan gene symbol?: mobA
  • synonym:
  • product: molybdenum cofactor guanylyltransferase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_RS12265 [old locus tag: SAUSA300_2220 ]
  • symbol: SAUSA300_RS12265
  • product: molybdenum cofactor guanylyltransferase
  • replicon: chromosome
  • strand: -
  • coordinates: 2390300..2390899
  • length: 600
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_007793 (2390300..2390899) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    ATGAAAGCAATAATTCTTGCAGGTGGTCATTCAGTGCGATTTGGTAAGCCCAAAGCTTTT
    GCGGAAGTGAACGGTGAGACCTTTTATAGTAGAGTAATTAAGACATTAGAATCAACAAAT
    ATGTTCAATGAAATTATTATTAGTACAAATGCGCAATTGGCAACGCAATTTAAATATCCA
    AATGTTGTTATAGATGATGAGAATCATAATGATAAAGGTCCATTAGCAGGAATTTATACA
    ATCATGAAGCAACATCCTGAAGAAGAATTGTTTTTTGTCGTTTCTGTTGATACACCAATG
    ATTACTGGTAAAGCTGTAAGCACGTTGTATCAGTTTTTAGTTTCTCATCTTATTGAAAAT
    CATTTAGATGTCGCAGCTTTTAAAGAAGATGGACGTTTTATTCCAACAATTGCATTTTAT
    AGTCCGAATGCATTAGGCGCTATAACTAAAGCACTACATTCTGATAATTACAGTTTTAAA
    AATGTATATCATGAATTATCAACGGATTATTTGGATGTAAGGGATGTAGATGCGCCCTCA
    TATTGGTACAAAAATATAAATTATCAGCATGATTTGGACGCTTTAATTCAAAAATTGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_RS12265 [old locus tag: SAUSA300_2220 ]
  • symbol: SAUSA300_RS12265
  • description: molybdenum cofactor guanylyltransferase
  • length: 199
  • theoretical pI: 5.81455
  • theoretical MW: 22541.4
  • GRAVY: -0.164824

Function[edit source | edit]

  • reaction:
    EC 2.7.7.77?  ExPASy
    Molybdenum cofactor guanylyltransferaseGTP + molybdenum cofactor = diphosphate + guanylyl molybdenum cofactor
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMolybdopterinmolybdenum cofactor guanylyltransferase (TIGR02665; EC 2.7.7.77; HMM-score: 88.2)
    molybdenum cofactor cytidylyltransferase (TIGR03310; EC 2.7.7.76; HMM-score: 32.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOther2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (TIGR00453; EC 2.7.7.60; HMM-score: 28.1)
    Hypothetical proteinsConservedTIGR00454 family protein (TIGR00454; HMM-score: 22.5)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesUDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase (TIGR01173; EC 2.3.1.157,2.7.7.23; HMM-score: 19.3)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanUDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase (TIGR01173; EC 2.3.1.157,2.7.7.23; HMM-score: 19.3)
    MetabolismCentral intermediary metabolismAmino sugarsUDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase (TIGR01173; EC 2.3.1.157,2.7.7.23; HMM-score: 19.3)
    xanthine dehydrogenase accessory protein pucB (TIGR03202; HMM-score: 16.2)
    pseudaminic acid cytidylyltransferase (TIGR03584; EC 2.7.7.81; HMM-score: 12.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOther2-phospho-L-lactate guanylyltransferase (TIGR03552; EC 2.7.7.68; HMM-score: 12.1)
  • TheSEED:
  • PFAM:
    GT-A (CL0110) NTP_transf_3; MobA-like NTP transferase domain (PF12804; HMM-score: 91.5)
    IspD; 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (PF01128; HMM-score: 16.6)
    CTP_transf_3; Cytidylyltransferase (PF02348; HMM-score: 14.9)
    Metallo-HOrase (CL0381) Lactamase_B_6; Metallo-beta-lactamase superfamily domain (PF16661; HMM-score: 14.6)
    CheY (CL0304) RcsC; RcsC Alpha-Beta-Loop (ABL) (PF09456; HMM-score: 14.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Mg2+
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.301
    • Ymax_pos: 22
    • Cmax: 0.308
    • Cmax_pos: 22
    • Smax: 0.405
    • Smax_pos: 8
    • Smean: 0.301
    • D: 0.301
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446566642 NCBI
  • RefSeq: WP_000643988 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKAIILAGGHSVRFGKPKAFAEVNGETFYSRVIKTLESTNMFNEIIISTNAQLATQFKYPNVVIDDENHNDKGPLAGIYTIMKQHPEEELFFVVSVDTPMITGKAVSTLYQFLVSHLIENHLDVAAFKEDGRFIPTIAFYSPNALGAITKALHSDNYSFKNVYHELSTDYLDVRDVDAPSYWYKNINYQHDLDALIQKL

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SAUSA300_RS12265 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]