From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS13300 [old locus tag: SAUSA300_2402 ]
  • pan locus tag?: SAUPAN006014000
  • symbol: SAUSA300_RS13300
  • pan gene symbol?:
  • synonym:
  • product: prevent-host-death protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_RS13300 [old locus tag: SAUSA300_2402 ]
  • symbol: SAUSA300_RS13300
  • product: prevent-host-death protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2587196..2587453
  • length: 258
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_007793 (2587196..2587453) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    ATGATTATCACTAGCCCTACAGAAGCGAGAAAAGATTTTTATCAATTACTAAAAAATGTT
    AATAATAATCACGAACCAATTTATATTAGTGGCAATAATGCCGAAAATAATGCTGTGATT
    ATAGGTTTAGAAGATTGGAAAAGTATACAAGAGACAATATATCTTGAATCTACTGGTACA
    ATGGACAAAGTAAGAGAAAGAGAAAAAGATAATAGTGGTACAACAAATATAGATGATATT
    GATTGGGATAATCTTTAA
    60
    120
    180
    240
    258

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_RS13300 [old locus tag: SAUSA300_2402 ]
  • symbol: SAUSA300_RS13300
  • description: prevent-host-death protein
  • length: 85
  • theoretical pI: 4.1354
  • theoretical MW: 9774.67
  • GRAVY: -0.805882

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cellular processesCellular processesToxin production and resistanceprevent-host-death family protein (TIGR01552; HMM-score: 37.9)
    Genetic information processingMobile and extrachromosomal element functionsOtherprevent-host-death family protein (TIGR01552; HMM-score: 37.9)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (TIGR00420; EC 2.1.1.61; HMM-score: 11.4)
  • TheSEED:
  • PFAM:
    Plasmid-antitox (CL0136) PhdYeFM_antitox; Antitoxin Phd_YefM, type II toxin-antitoxin system (PF02604; HMM-score: 62.8)
    PHD_like; Antitoxin of toxin-antitoxin, RelE / RelB, TA system (PF12910; HMM-score: 21.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.139
    • Ymax_pos: 12
    • Cmax: 0.113
    • Cmax_pos: 12
    • Smax: 0.286
    • Smax_pos: 8
    • Smean: 0.18
    • D: 0.155
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446510098 NCBI
  • RefSeq: WP_000587616 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MIITSPTEARKDFYQLLKNVNNNHEPIYISGNNAENNAVIIGLEDWKSIQETIYLESTGTMDKVREREKDNSGTTNIDDIDWDNL

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SAUSA300_RS13300 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]