From AureoWiki
Jump to: navigation, search
04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS14875 [old locus tag: SAUSA300_pUSA030028 ]
  • pan locus tag?:
  • symbol: SAUSA300_RS14875
  • pan gene symbol?:
  • synonym:
  • product: transposase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_RS14875 [old locus tag: SAUSA300_pUSA030028 ]
  • symbol: SAUSA300_RS14875
  • product: transposase
  • replicon: pUSA03
  • strand: +
  • coordinates: 26810..27367
  • length: 558
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_007792 (26810..27367) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    ATGGCCAATATTGGTTATGCTCGTGTATCTACCAGAGATCAAAGTTTAGATTTACAAATA
    GACGCTTTGAGTAATTTTGGTTGTGAGAAAATATTTAGCGAAAAAGTTAGTGGGCGTAAA
    GTAAATAGAACTGAACTAGATAAATGTTTAGATTATTTACGTGAAGGCGACACTTTAGTT
    ATTTACAAGCTAGATAGATTAGGCAGGACTACTAAGCAACTGATAGATTTAGCCCAATGG
    TTAGAAAATAATAATATTGAATTACAAATTATTGATATGAATATCAATACAAAAGACCCA
    ATGGGAAAGATGTTTTTTACAATGATGAGTGCTTTTGCTGAATTAGAGGCTAACTTATTA
    AGCGAAAGAACTAAAAAAGGTTTAGAATCAGCTAGAGCAAGAGGTAACATGGGAGGCAGA
    AAAGCAATGCCACAAGAAAAAAAAGAATACATTAAACATTTATACGATACCAAAGAATAT
    ACAGGACAAGAAATTGCTAAAAAAACGAATGTAAGTAGAGATACTGTATATCGCATTTTA
    CGAGAGTTTAAAAAGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    558

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_RS14875 [old locus tag: SAUSA300_pUSA030028 ]
  • symbol: SAUSA300_RS14875
  • description: transposase
  • length: 185
  • theoretical pI: 9.66653
  • theoretical MW: 21417.5
  • GRAVY: -0.663784

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 20.4)
    Unknown functionGeneralDNA binding domain, excisionase family (TIGR01764; HMM-score: 19.8)
    Genetic information processingMobile and extrachromosomal element functionsProphage functionsphage-associated protein, BcepMu gp16 family (TIGR04111; HMM-score: 14)
    Signal transductionRegulatory functionsDNA interactionsCRISPR locus-related DNA-binding protein (TIGR01884; HMM-score: 12.9)
  • TheSEED:
  • PFAM:
    no clan definedResolvase; Resolvase, N terminal domain (PF00239; HMM-score: 151.2)
    HTH (CL0123) HTH_7; Helix-turn-helix domain of resolvase (PF02796; HMM-score: 33.2)
    HTH_23; Homeodomain-like domain (PF13384; HMM-score: 27)
    HTH_11; HTH domain (PF08279; HMM-score: 25.6)
    HTH_29; Winged helix-turn helix (PF13551; HMM-score: 24.3)
    HTH_32; Homeodomain-like domain (PF13565; HMM-score: 23.3)
    TrmB; Sugar-specific transcriptional regulator TrmB (PF01978; HMM-score: 19.6)
    HTH_22; HTH domain (PF13309; HMM-score: 19.5)
    HTH_38; Helix-turn-helix domain (PF13936; HMM-score: 19.4)
    Mga; Mga helix-turn-helix domain (PF05043; HMM-score: 18.7)
    HTH_Crp_2; Crp-like helix-turn-helix domain (PF13545; HMM-score: 17.3)
    UPF0122; Putative helix-turn-helix protein, YlxM / p13 like (PF04297; HMM-score: 17)
    HTH_28; Helix-turn-helix domain (PF13518; HMM-score: 16.8)
    Sigma70_r4; Sigma-70, region 4 (PF04545; HMM-score: 16.4)
    no clan definedDUF4277; Domain of unknown function (DUF4277) (PF14104; HMM-score: 15.7)
    HTH (CL0123) HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 15.1)
    CENP-B_N; CENP-B N-terminal DNA-binding domain (PF04218; HMM-score: 14.5)
    HTH_36; Helix-turn-helix domain (PF13730; HMM-score: 14.5)
    HTH_10; HTH DNA binding domain (PF04967; HMM-score: 14.3)
    HTH_17; Helix-turn-helix domain (PF12728; HMM-score: 14.2)
    Sigma70_r4_2; Sigma-70, region 4 (PF08281; HMM-score: 13.7)
    HTH_Mga; M protein trans-acting positive regulator (MGA) HTH domain (PF08280; HMM-score: 13.2)
    HTH_26; Cro/C1-type HTH DNA-binding domain (PF13443; HMM-score: 13.1)
    no clan definedTnsD; Tn7-like transposition protein D (PF15978; HMM-score: 13)
    HTH (CL0123) HTH_3; Helix-turn-helix (PF01381; HMM-score: 13)
    Rrf2; Transcriptional regulator (PF02082; HMM-score: 12.8)
    HTH_Tnp_ISL3; Helix-turn-helix domain of transposase family ISL3 (PF13542; HMM-score: 12.2)
    HTH_46; Winged helix-turn-helix DNA binding (PF15977; HMM-score: 12.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.107
    • Ymax_pos: 34
    • Cmax: 0.11
    • Cmax_pos: 34
    • Smax: 0.144
    • Smax_pos: 33
    • Smean: 0.088
    • D: 0.1
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 447196603 NCBI
  • RefSeq: WP_001273859 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MANIGYARVSTRDQSLDLQIDALSNFGCEKIFSEKVSGRKVNRTELDKCLDYLREGDTLVIYKLDRLGRTTKQLIDLAQWLENNNIELQIIDMNINTKDPMGKMFFTMMSAFAELEANLLSERTKKGLESARARGNMGGRKAMPQEKKEYIKHLYDTKEYTGQEIAKKTNVSRDTVYRILREFKK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SAUSA300_RS14875 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]