Due to technical reasons this service will not be available for 7 days from 27 Nov to 04 Dec 2017
From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS02375 [old locus tag: SA0416 ]
  • pan locus tag?: SAUPAN002170000
  • symbol: SA_RS02375
  • pan gene symbol?:
  • synonym:
  • product: carboxylesterase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS02375 [old locus tag: SA0416 ]
  • symbol: SA_RS02375
  • product: carboxylesterase
  • replicon: chromosome
  • strand: +
  • coordinates: 477047..477781
  • length: 735
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (477047..477781) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAGAATTAAAACACCGAGTCCATCTTATTTAAAAGGCACAAATGGACATGCGATATTA
    TTATTACATTCATTTACAGGTACAAATCGGGATGTGAAGCATCTTGCAGCTGAGTTAAAT
    GACCAAGGATTTAGTTGTTATGCACCGAATTATCCAGGTCATGGTTTACTGTTGAAAGAT
    TTCATGACATATAATGTAGATGATTGGTGGGAAGAAGTTGAGAAAGCTTACCAATTTTTA
    GTCAATGAAGGTTATGAATCTATCAGTGCAACGGGTGTGTCTTTAGGTGGATTAATGACA
    TTAAAATTGGCGCAGCACTACCCGTTGAAACGTATCGCTGTCATGTCAGCACCAAAGGAA
    AAAAGTGATGATGGCTTAATAGAACATTTAGTTTATTATAGTCAACGCATGTCGAATATT
    TTAAATTTAGATCAGCAAGCATCGAGTGCGCAATTAGCAGCAATTGATGATTATGAAGGT
    GAAATTACGAAGTTTCAGCATTTTATTGATGATATCATGACAAATTTAAATGTTATTAAA
    ATTCCAGCTAATATATTATTTGGTGGTAAAGATGAGCCATCCTATGAAACAAGTGCACAT
    TTTATTTATGAACATTTAGGATCAGTAGACAAAGAATTAAATGGTCTGAAGGATTCGCAT
    CATTTAATGACACATGGAGAAGGCAGAGATATTTTAGAAGAAAATGTTATTCGCTTTTTC
    AATGCTTTAACATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    735

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS02375 [old locus tag: SA0416 ]
  • symbol: SA_RS02375
  • description: carboxylesterase
  • length: 244
  • theoretical pI: 5.28596
  • theoretical MW: 27482.8
  • GRAVY: -0.323361

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (TIGR03695; EC 4.2.99.20; HMM-score: 32.2)
    MetabolismEnergy metabolismOther3-oxoadipate enol-lactonase (TIGR02427; EC 3.1.1.24; HMM-score: 22.5)
    exosortase A system-associated hydrolase 2 (TIGR03101; HMM-score: 20.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersBiotinpimelyl-[acyl-carrier protein] methyl ester esterase (TIGR01738; EC 3.1.1.85; HMM-score: 19.2)
    MetabolismEnergy metabolismPhotosynthesisputative magnesium chelatase accessory protein (TIGR03056; HMM-score: 17.4)
    cyanobacterial long protein repeat (TIGR02059; HMM-score: 16.7)
    Plasmodium subtelomeric family (TIGR01607; HMM-score: 11.5)
  • TheSEED:
  • PFAM:
    AB_hydrolase (CL0028) Hydrolase_4; Serine aminopeptidase, S33 (PF12146; HMM-score: 56.7)
    Abhydrolase_6; Alpha/beta hydrolase family (PF12697; HMM-score: 29.2)
    Abhydrolase_1; alpha/beta hydrolase fold (PF00561; HMM-score: 19.8)
    DLH; Dienelactone hydrolase family (PF01738; HMM-score: 18.1)
    UPF0227; Uncharacterised protein family (UPF0227) (PF05728; HMM-score: 14.3)
    Esterase; Putative esterase (PF00756; HMM-score: 13.3)
    Peptidase_S9; Prolyl oligopeptidase family (PF00326; HMM-score: 12.3)
    DUF2048; Abhydrolase domain containing 18 (PF09752; HMM-score: 12)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.204
    • Ymax_pos: 12
    • Cmax: 0.164
    • Cmax_pos: 37
    • Smax: 0.567
    • Smax_pos: 1
    • Smean: 0.375
    • D: 0.271
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 447143555 NCBI
  • RefSeq: WP_001220811 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MRIKTPSPSYLKGTNGHAILLLHSFTGTNRDVKHLAAELNDQGFSCYAPNYPGHGLLLKDFMTYNVDDWWEEVEKAYQFLVNEGYESISATGVSLGGLMTLKLAQHYPLKRIAVMSAPKEKSDDGLIEHLVYYSQRMSNILNLDQQASSAQLAAIDDYEGEITKFQHFIDDIMTNLNVIKIPANILFGGKDEPSYETSAHFIYEHLGSVDKELNGLKDSHHLMTHGEGRDILEENVIRFFNALT

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS02375 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]