From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS02620 [old locus tag: SA0455 ]
  • pan locus tag?: SAUPAN002235000
  • symbol: SA_RS02620
  • pan gene symbol?: yabJ
  • synonym:
  • product: RidA family protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS02620 [old locus tag: SA0455 ]
  • symbol: SA_RS02620
  • product: RidA family protein
  • replicon: chromosome
  • strand: +
  • coordinates: 525948..526328
  • length: 381
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (525948..526328) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    ATGAAAATCATTAACACAACAAGATTACCGGAAGCACTTGGACCATATTCGCATGCAACA
    GTTGTGAATGGTATGGTTTATACTTCTGGTCAGATTCCATTGAATGTTGATGGGAAAATC
    GTAAGCGCTGATGTTCAAGCACAGACAAAACAAGTTTTAGAAAATTTAAAGGTTGTTTTG
    GAAGAAGCAGGATCTGATTTGAATTCTGTTGCGAAAGCGACCATTTTCATTAAAGATATG
    AATGATTTCCAAAAAATAAATGAAGTGTATGGTCAATATTTTAATGAACACAAGCCAGCG
    CGTAGTTGTGTAGAGGTTGCGCGTTTGCCAAAAGATGTGAAAGTAGAAATTGAATTAGTA
    AGTAAAATTAAGGAATTATAA
    60
    120
    180
    240
    300
    360
    381

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS02620 [old locus tag: SA0455 ]
  • symbol: SA_RS02620
  • description: RidA family protein
  • length: 126
  • theoretical pI: 6.52767
  • theoretical MW: 13973
  • GRAVY: -0.147619

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cellular processesCellular processesOtherreactive intermediate/imine deaminase (TIGR00004; HMM-score: 170.3)
    and 2 more
    pyrimidine utilization protein C (TIGR03610; HMM-score: 99.4)
    amanitin/phalloidin family toxin (TIGR04309; HMM-score: 11.8)
  • TheSEED:
  • PFAM:
    YjgF-like (CL0534) Ribonuc_L-PSP; Endoribonuclease L-PSP (PF01042; HMM-score: 150.1)
    and 2 more
    no clan definedRab3-GTPase_cat; Rab3 GTPase-activating protein catalytic subunit (PF13890; HMM-score: 12.7)
    Eclosion; Eclosion hormone (PF04736; HMM-score: 12)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.171
    • Ymax_pos: 20
    • Cmax: 0.14
    • Cmax_pos: 39
    • Smax: 0.33
    • Smax_pos: 7
    • Smean: 0.222
    • D: 0.191
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446614428 NCBI
  • RefSeq: WP_000691774 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKIINTTRLPEALGPYSHATVVNGMVYTSGQIPLNVDGKIVSADVQAQTKQVLENLKVVLEEAGSDLNSVAKATIFIKDMNDFQKINEVYGQYFNEHKPARSCVEVARLPKDVKVEIELVSKIKEL

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS02620 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]