From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS07180 [old locus tag: SA1266 ]
  • pan locus tag?: SAUPAN003871000
  • symbol: SA_RS07180
  • pan gene symbol?:
  • synonym:
  • product: ribonuclease H

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS07180 [old locus tag: SA1266 ]
  • symbol: SA_RS07180
  • product: ribonuclease H
  • replicon: chromosome
  • strand: +
  • coordinates: 1437468..1437869
  • length: 402
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (1437468..1437869) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    ATGGCGAAAATAAATTTTGATGCTGCGACGAAAGGAAATCCAGGCATAAGTACATGTGCC
    ATTGTAATCAAAGAAGATAAGCAGCATTATACATATACACATGAGTTAGGCGAAATGGAT
    AACCACACTGCAGAATGGGCTGCATGTATTTATGCACTAGAACATGCACGTGAATTAAAT
    GTTCAAAACGCACTATTATATACAGACTCAAAGCTAATTGCAGATAGCATTGAAGCTGGT
    TATGTGAAAAACGCAAATTTCAAACCTTATTTTGATCAAATAGAAATATTTGAAAAAGAT
    TTTGATTTATTATTTGTTAAATGGATACCGAGAGAACAAAACAAAGAAGCGAATCAACAC
    GCTCAACAGGCATTGTATAAATTAATTAAAAAGAATAAATAA
    60
    120
    180
    240
    300
    360
    402

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS07180 [old locus tag: SA1266 ]
  • symbol: SA_RS07180
  • description: ribonuclease H
  • length: 133
  • theoretical pI: 6.34919
  • theoretical MW: 15353.3
  • GRAVY: -0.532331

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:
  • PFAM:
    RNase_H (CL0219) RVT_3; Reverse transcriptase-like (PF13456; HMM-score: 61.1)
    RNase_H; RNase H (PF00075; HMM-score: 31.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cellwall
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 9.2
    • Extracellular Score: 0.78
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.136
    • Ymax_pos: 30
    • Cmax: 0.119
    • Cmax_pos: 48
    • Smax: 0.219
    • Smax_pos: 19
    • Smean: 0.147
    • D: 0.14
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446985690 NCBI
  • RefSeq: WP_001062946 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MAKINFDAATKGNPGISTCAIVIKEDKQHYTYTHELGEMDNHTAEWAACIYALEHARELNVQNALLYTDSKLIADSIEAGYVKNANFKPYFDQIEIFEKDFDLLFVKWIPREQNKEANQHAQQALYKLIKKNK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS07180 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]