From AureoWiki
Jump to navigation Jump to search

NCBI: 01-DEC-2025

Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: EGJ38_001027 [new locus tag: EGJ38_RS05130 ]
  • pan locus tag?: SAUPAN003273000
  • symbol: EGJ38_001027
  • pan gene symbol?:
  • synonym:
  • alternate name: JSNZ_001027
  • product: DUF5011 domain-containing protein

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: EGJ38_001027 [new locus tag: EGJ38_RS05130 ]
  • symbol: EGJ38_001027
  • product: DUF5011 domain-containing protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1031118..1031435
  • length: 318
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Gene ID:
  • RefSeq: MGT2422996 NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    ATGAATAAACTATTACAGTCATTATCAGCCCTCGGTGTTTCTGCTACACTAGTAACACCA
    AATTTAAATGCAGATGCAACGACGAATACTACACCACAAATTAAAGGCGCTAATGATATC
    GTTATTAAGAAAGGTCAAGATTATAACCTTCTAAACGGCATAAGTGCATTTGATAAAGAA
    GATGGAGATTTAACCGATAAAATTAAAGTCGATGGCCAAATTGATACATCTAAATCTGGT
    AAATATCAAATTAAATATCATGTCACTGATTCAGATGGTGCAATTAAAATTTCCACTAGG
    TATATTGAGGTTAAATAG
    60
    120
    180
    240
    300
    318


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: EGJ38_001027 [new locus tag: EGJ38_RS05130 ]
  • symbol: EGJ38_001027
  • description: DUF5011 domain-containing protein
  • length: 105
  • theoretical pI: 7.5126
  • theoretical MW: 11344.7
  • GRAVY: -0.431429

Function[edit | edit source]

  • TIGRFAM:
  • TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
  • PFAM:
    E-set (CL0159) Bact_surface_Ig-like; Bacterial surface protein, Ig-like domain (PF16403; HMM-score: 83.3)
    and 6 more
    Big_3; Bacterial Ig-like domain (group 3) (PF07523; HMM-score: 20.9)
    CopC; CopC domain (PF04234; HMM-score: 16.7)
    Rib; Rib domain (PF08428; HMM-score: 15.9)
    no clan defined DUF7013; Domain of unknown function (DUF7013) (PF22793; HMM-score: 14.8)
    E-set (CL0159) DUF4625; Domain of unknown function (DUF4625) (PF15418; HMM-score: 14.4)
    Big_9; Bacterial Ig domain (PF17963; HMM-score: 14.4)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 3.33
    • Cellwall Score: 3.33
    • Extracellular Score: 3.33
    • Internal Helices: 0
  • DeepLocPro: Extracellular
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.0044
    • Cell wall & surface Score: 0.0159
    • Extracellular Score: 0.9796
  • LocateP:
  • SignalP: Signal peptide SP(Sec/SPI) length 26 aa
    • SP(Sec/SPI): 0.972948
    • TAT(Tat/SPI): 0.020365
    • LIPO(Sec/SPII): 0.002926
    • Cleavage Site: CS pos: 26-27. ADA-TT. Pr: 0.6096
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq: MGT2422996 NCBI
  • UniProt:

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MNKLLQSLSALGVSATLVTPNLNADATTNTTPQIKGANDIVIKKGQDYNLLNGISAFDKEDGDLTDKIKVDGQIDTSKSGKYQIKYHVTDSDGAIKISTRYIEVK

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: VraR (activation) regulon
    VraR(TF)response regulator important for resistance against cell-wall targeting antibiotics;  [1] [2]

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Makoto Kuroda, Hiroko Kuroda, Taku Oshima, Fumihiko Takeuchi, Hirotada Mori, Keiichi Hiramatsu
    Two-component system VraSR positively modulates the regulation of cell-wall biosynthesis pathway in Staphylococcus aureus.
    Mol Microbiol: 2003, 49(3);807-21
    [PubMed:12864861] [WorldCat.org] [DOI] (P p)
  2. Susan Boyle-Vavra, Shouhui Yin, Dae Sun Jo, Christopher P Montgomery, Robert S Daum
    VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus.
    Antimicrob Agents Chemother: 2013, 57(1);83-95
    [PubMed:23070169] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]