Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL1071 [new locus tag: SACOL_RS05465 ]
- pan locus tag?: SAUPAN003273000
- symbol: SACOL1071
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL1071 [new locus tag: SACOL_RS05465 ]
- symbol: SACOL1071
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 1080738..1081055
- length: 318
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3237877 NCBI
- RefSeq: YP_185935 NCBI
- BioCyc: see SACOL_RS05465
- MicrobesOnline: 912539 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301ATGAATAAACTATTACAGTCATTATCAGCCCTCGGTGTTTCTGCTACACTAGTAACACCA
AATTTAAATGCAGATGCAACGACGAATACTACACCACAAATTAAAGGCGCTAATGATATC
GTTATTAAGAAAGGTCAAGATTATAACCTTCTAAACGGCATAAGTGCATTTGATAAAGAA
GATGGAGATTTAACCGATAAAATTAAAGTCGATGGCCAAATTGATACATCTAAATCTGGT
AAATATCAAATTAAATATCATGTCACTGATTCAGATGGTGCAATTAAAATTTCCACTAGG
TATATTGAGGTTAAATAG60
120
180
240
300
318
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL1071 [new locus tag: SACOL_RS05465 ]
- symbol: SACOL1071
- description: hypothetical protein
- length: 105
- theoretical pI: 7.5126
- theoretical MW: 11344.7
- GRAVY: -0.431429
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED :
- Chitinase B
- PFAM: E-set (CL0159) Bact_surface_Ig-like; Bacterial surface protein, Ig-like domain (PF16403; HMM-score: 83.3)and 6 moreBig_3; Bacterial Ig-like domain (group 3) (PF07523; HMM-score: 20.9)CopC; CopC domain (PF04234; HMM-score: 16.7)Rib; Rib domain (PF08428; HMM-score: 15.9)no clan defined DUF7013; Domain of unknown function (DUF7013) (PF22793; HMM-score: 14.8)E-set (CL0159) DUF4625; Domain of unknown function (DUF4625) (PF15418; HMM-score: 14.4)Big_9; Bacterial Ig domain (PF17963; HMM-score: 14.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 3.33
- Cellwall Score: 3.33
- Extracellular Score: 3.33
- Internal Helices: 0
- DeepLocPro: Extracellular
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 0.0044
- Cell wall & surface Score: 0.0159
- Extracellular Score: 0.9796
- LocateP: Secretory(released) (with CS)
- Prediction by SwissProt Classification: Extracellular
- Pathway Prediction: Sec-(SPI)
- Intracellular possibility: -0.17
- Signal peptide possibility: 1
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: LNADATTN
- SignalP: Signal peptide SP(Sec/SPI) length 26 aa
- SP(Sec/SPI): 0.972948
- TAT(Tat/SPI): 0.020365
- LIPO(Sec/SPII): 0.002926
- Cleavage Site: CS pos: 26-27. ADA-TT. Pr: 0.6096
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MNKLLQSLSALGVSATLVTPNLNADATTNTTPQIKGANDIVIKKGQDYNLLNGISAFDKEDGDLTDKIKVDGQIDTSKSGKYQIKYHVTDSDGAIKISTRYIEVK
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Signal peptide containing [1] [2]
- quantitative data / protein copy number per cell:
- interaction partners:
SACOL1760 (ackA) acetate kinase [3] (data from MRSA252) SACOL1385 (acnA) aconitate hydratase [3] (data from MRSA252) SACOL2218 (adk) adenylate kinase [3] (data from MRSA252) SACOL0452 (ahpC) alkyl hydroperoxide reductase subunit C [3] (data from MRSA252) SACOL1673 (alaS) alanyl-tRNA synthetase [3] (data from MRSA252) SACOL2657 (arcA) arginine deiminase [3] (data from MRSA252) SACOL2656 (arcB2) ornithine carbamoyltransferase [3] (data from MRSA252) SACOL0570 (clpC) [3] (data from MRSA252) SACOL0557 (cysK) cysteine synthase [3] (data from MRSA252) SACOL0123 (deoC1) deoxyribose-phosphate aldolase [3] (data from MRSA252) SACOL2130 (deoD) purine nucleoside phosphorylase [3] (data from MRSA252) SACOL1637 (dnaK) molecular chaperone DnaK [3] (data from MRSA252) SACOL1587 (efp) elongation factor P [3] (data from MRSA252) SACOL0842 (eno) phosphopyruvate hydratase [3] (data from MRSA252) SACOL0988 (fabF) 3-oxoacyl-ACP synthase [3] (data from MRSA252) SACOL1245 (fabG1) 3-oxoacyl-ACP reductase [3] (data from MRSA252) SACOL2117 (fbaA) fructose-bisphosphate aldolase [3] (data from MRSA252) SACOL2622 (fdaB) fructose-1,6-bisphosphate aldolase [3] (data from MRSA252) SACOL1329 (femC) glutamine synthetase [3] (data from MRSA252) SACOL1782 (fhs) formate--tetrahydrofolate ligase [3] (data from MRSA252) SACOL1072 (folD) bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase [3] (data from MRSA252) SACOL1278 (frr) ribosome recycling factor [3] (data from MRSA252) SACOL1199 (ftsZ) cell division protein FtsZ [3] (data from MRSA252) SACOL0593 (fusA) elongation factor G [3] (data from MRSA252) SACOL0838 (gapA1) glyceraldehyde 3-phosphate dehydrogenase [3] (data from MRSA252) SACOL1734 (gapA2) glyceraldehyde 3-phosphate dehydrogenase 2 [3] (data from MRSA252) SACOL1961 (gatA) aspartyl/glutamyl-tRNA amidotransferase subunit A [3] (data from MRSA252) SACOL0877 (gcvH) glycine cleavage system protein H [3] (data from MRSA252) SACOL2145 (glmS) glucosamine--fructose-6-phosphate aminotransferase [3] (data from MRSA252) SACOL0961 (gluD) glutamate dehydrogenase [3] (data from MRSA252) SACOL1622 (glyS) glycyl-tRNA synthetase [3] (data from MRSA252) SACOL1554 (gnd) 6-phosphogluconate dehydrogenase [3] (data from MRSA252) SACOL2016 (groEL) chaperonin GroEL [3] (data from MRSA252) SACOL0461 (guaA) GMP synthase [3] (data from MRSA252) SACOL0460 (guaB) inosine-5'-monophosphate dehydrogenase [3] (data from MRSA252) SACOL1513 (hup) DNA-binding protein HU [3] (data from MRSA252) SACOL1741 (icd) isocitrate dehydrogenase [3] (data from MRSA252) SACOL1288 (infB) translation initiation factor IF-2 [3] (data from MRSA252) SACOL1727 (infC) translation initiation factor IF-3 [3] (data from MRSA252) SACOL1368 (kataA) catalase [3] (data from MRSA252) SACOL0222 (ldh1) L-lactate dehydrogenase [3] (data from MRSA252) SACOL2623 (mqo2) malate:quinone oxidoreductase [3] (data from MRSA252) SACOL2116 (murAB) UDP-N-acetylglucosamine 1-carboxyvinyltransferase [3] (data from MRSA252) SACOL0746 (norR) MarR family transcriptional regulator [3] (data from MRSA252) SACOL1285 (nusA) transcription elongation factor NusA [3] (data from MRSA252) SACOL0582 (nusG) transcription antitermination protein [3] (data from MRSA252) SACOL1102 (pdhA) pyruvate dehydrogenase complex E1 component subunit alpha [3] (data from MRSA252) SACOL1103 (pdhB) pyruvate dehydrogenase complex E1 component subunit beta [3] (data from MRSA252) SACOL1104 (pdhC) branched-chain alpha-keto acid dehydrogenase E2 [3] (data from MRSA252) SACOL1105 (pdhD) dihydrolipoamide dehydrogenase [3] (data from MRSA252) SACOL2128 (pdp) pyrimidine-nucleoside phosphorylase [3] (data from MRSA252) SACOL1005 (pepF) oligoendopeptidase F [3] (data from MRSA252) SACOL1746 (pfkA) 6-phosphofructokinase [3] (data from MRSA252) SACOL0204 (pflB) formate acetyltransferase [3] (data from MRSA252) SACOL0966 (pgi) glucose-6-phosphate isomerase [3] (data from MRSA252) SACOL0839 (pgk) phosphoglycerate kinase [3] (data from MRSA252) SACOL0841 (pgm) phosphoglyceromutase [3] (data from MRSA252) SACOL1293 (pnp) polynucleotide phosphorylase/polyadenylase [3] (data from MRSA252) SACOL1982 (ppaC) manganese-dependent inorganic pyrophosphatase [3] (data from MRSA252) SACOL1091 (ptsH) phosphocarrier protein HPr [3] (data from MRSA252) SACOL1092 (ptsI) phosphoenolpyruvate-protein phosphotransferase [3] (data from MRSA252) SACOL1745 (pyk) pyruvate kinase [3] (data from MRSA252) SACOL0584 (rplA) 50S ribosomal protein L1 [3] (data from MRSA252) SACOL2236 (rplB) 50S ribosomal protein L2 [3] (data from MRSA252) SACOL2239 (rplC) 50S ribosomal protein L3 [3] (data from MRSA252) SACOL2238 (rplD) 50S ribosomal protein L4 [3] (data from MRSA252) SACOL2227 (rplE) 50S ribosomal protein L5 [3] (data from MRSA252) SACOL2224 (rplF) 50S ribosomal protein L6 [3] (data from MRSA252) SACOL0015 (rplI) 50S ribosomal protein L9 [3] (data from MRSA252) SACOL0585 (rplJ) 50S ribosomal protein L10 [3] (data from MRSA252) SACOL0583 (rplK) 50S ribosomal protein L11 [3] (data from MRSA252) SACOL0586 (rplL) 50S ribosomal protein L7/L12 [3] (data from MRSA252) SACOL2207 (rplM) 50S ribosomal protein L13 [3] (data from MRSA252) SACOL2220 (rplO) 50S ribosomal protein L15 [3] (data from MRSA252) SACOL2232 (rplP) 50S ribosomal protein L16 [3] (data from MRSA252) SACOL2212 (rplQ) 50S ribosomal protein L17 [3] (data from MRSA252) SACOL1257 (rplS) 50S ribosomal protein L19 [3] (data from MRSA252) SACOL1725 (rplT) 50S ribosomal protein L20 [3] (data from MRSA252) SACOL1702 (rplU) 50S ribosomal protein L21 [3] (data from MRSA252) SACOL2234 (rplV) 50S ribosomal protein L22 [3] (data from MRSA252) SACOL2237 (rplW) 50S ribosomal protein L23 [3] (data from MRSA252) SACOL0545 (rplY) 50S ribosomal protein L25/general stress protein Ctc [3] (data from MRSA252) SACOL2112 (rpmE2) 50S ribosomal protein L31 [3] (data from MRSA252) SACOL2213 (rpoA) DNA-directed RNA polymerase subunit alpha [3] (data from MRSA252) SACOL0588 (rpoB) DNA-directed RNA polymerase subunit beta [3] (data from MRSA252) SACOL0589 (rpoC) DNA-directed RNA polymerase subunit beta' [3] (data from MRSA252) SACOL1516 (rpsA) 30S ribosomal protein S1 [3] (data from MRSA252) SACOL1274 (rpsB) 30S ribosomal protein S2 [3] (data from MRSA252) SACOL2233 (rpsC) 30S ribosomal protein S3 [3] (data from MRSA252) SACOL1769 (rpsD) 30S ribosomal protein S4 [3] (data from MRSA252) SACOL2222 (rpsE) 30S ribosomal protein S5 [3] (data from MRSA252) SACOL0437 (rpsF) 30S ribosomal protein S6 [3] (data from MRSA252) SACOL0592 (rpsG) 30S ribosomal protein S7 [3] (data from MRSA252) SACOL2225 (rpsH) 30S ribosomal protein S8 [3] (data from MRSA252) SACOL2206 (rpsI) 30S ribosomal protein S9 [3] (data from MRSA252) SACOL2240 (rpsJ) 30S ribosomal protein S10 [3] (data from MRSA252) SACOL2214 (rpsK) 30S ribosomal protein S11 [3] (data from MRSA252) SACOL2215 (rpsM) 30S ribosomal protein S13 [3] (data from MRSA252) SACOL2230 (rpsQ) 30S ribosomal protein S17 [3] (data from MRSA252) SACOL2235 (rpsS) 30S ribosomal protein S19 [3] (data from MRSA252) SACOL1610 (sodA2) superoxide dismutase [3] (data from MRSA252) SACOL0095 (spa) immunoglobulin G binding protein A precursor [3] (data from MRSA252) SACOL1449 (sucA) 2-oxoglutarate dehydrogenase E1 component [3] (data from MRSA252) SACOL1448 (sucB) dihydrolipoamide succinyltransferase [3] (data from MRSA252) SACOL1262 (sucC) succinyl-CoA synthetase subunit beta [3] (data from MRSA252) SACOL1263 (sucD) succinyl-CoA synthetase subunit alpha [3] (data from MRSA252) SACOL1831 (tal) translaldolase [3] (data from MRSA252) SACOL1729 (thrS) threonyl-tRNA synthetase [3] (data from MRSA252) SACOL1722 (tig) trigger factor [3] (data from MRSA252) SACOL1377 (tkt) transketolase [3] (data from MRSA252) SACOL0840 (tpiA) triosephosphate isomerase [3] (data from MRSA252) SACOL1762 (tpx) thiol peroxidase [3] (data from MRSA252) SACOL1155 (trxA) thioredoxin [3] (data from MRSA252) SACOL1276 (tsf) elongation factor Ts [3] (data from MRSA252) SACOL0594 (tuf) elongation factor Tu [3] (data from MRSA252) SACOL2104 (upp) uracil phosphoribosyltransferase [3] (data from MRSA252) SACOL0426 acetyl-CoA acetyltransferase [3] (data from MRSA252) SACOL0506 ABC transporter substrate-binding protein [3] (data from MRSA252) SACOL0617 hexulose-6-phosphate synthase [3] (data from MRSA252) SACOL0721 hypothetical protein [3] (data from MRSA252) SACOL0815 ribosomal subunit interface protein [3] (data from MRSA252) SACOL0876 hypothetical protein [3] (data from MRSA252) SACOL0944 NADH dehydrogenase [3] (data from MRSA252) SACOL0973 fumarylacetoacetate hydrolase [3] (data from MRSA252) SACOL1099 hypothetical protein [3] (data from MRSA252) SACOL1205 hypothetical protein [3] (data from MRSA252) SACOL1437 CSD family cold shock protein [3] (data from MRSA252) SACOL1594 glycine dehydrogenase subunit 1 [3] (data from MRSA252) SACOL1670 hypothetical protein [3] (data from MRSA252) SACOL1753 universal stress protein [3] (data from MRSA252) SACOL1759 universal stress protein [3] (data from MRSA252) SACOL1792 hypothetical protein [3] (data from MRSA252) SACOL1801 dipeptidase PepV [3] (data from MRSA252) SACOL1952 ferritins family protein [3] (data from MRSA252) SACOL2173 alkaline shock protein 23 [3] (data from MRSA252) SACOL2535 D-lactate dehydrogenase [3] (data from MRSA252) SACOL2553 pyruvate oxidase [3] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator: VraR (activation) regulon
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ 3.000 3.001 3.002 3.003 3.004 3.005 3.006 3.007 3.008 3.009 3.010 3.011 3.012 3.013 3.014 3.015 3.016 3.017 3.018 3.019 3.020 3.021 3.022 3.023 3.024 3.025 3.026 3.027 3.028 3.029 3.030 3.031 3.032 3.033 3.034 3.035 3.036 3.037 3.038 3.039 3.040 3.041 3.042 3.043 3.044 3.045 3.046 3.047 3.048 3.049 3.050 3.051 3.052 3.053 3.054 3.055 3.056 3.057 3.058 3.059 3.060 3.061 3.062 3.063 3.064 3.065 3.066 3.067 3.068 3.069 3.070 3.071 3.072 3.073 3.074 3.075 3.076 3.077 3.078 3.079 3.080 3.081 3.082 3.083 3.084 3.085 3.086 3.087 3.088 3.089 3.090 3.091 3.092 3.093 3.094 3.095 3.096 3.097 3.098 3.099 3.100 3.101 3.102 3.103 3.104 3.105 3.106 3.107 3.108 3.109 3.110 3.111 3.112 3.113 3.114 3.115 3.116 3.117 3.118 3.119 3.120 3.121 3.122 3.123 3.124 3.125 3.126 3.127 3.128 3.129 3.130 3.131 3.132 3.133 3.134 3.135 3.136 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p) - ↑ Makoto Kuroda, Hiroko Kuroda, Taku Oshima, Fumihiko Takeuchi, Hirotada Mori, Keiichi Hiramatsu
Two-component system VraSR positively modulates the regulation of cell-wall biosynthesis pathway in Staphylococcus aureus.
Mol Microbiol: 2003, 49(3);807-21
[PubMed:12864861] [WorldCat.org] [DOI] (P p) - ↑ Susan Boyle-Vavra, Shouhui Yin, Dae Sun Jo, Christopher P Montgomery, Robert S Daum
VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus.
Antimicrob Agents Chemother: 2013, 57(1);83-95
[PubMed:23070169] [WorldCat.org] [DOI] (I p)