Jump to navigation
Jump to search
NCBI: 22-FEB-2026
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: EGJ38_RS05130 [old locus tag: EGJ38_001027 ]
- pan locus tag?: SAUPAN003273000
- symbol: EGJ38_RS05130
- pan gene symbol?: —
- synonym:
- product: DUF5011 domain-containing protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: EGJ38_RS05130 [old locus tag: EGJ38_001027 ]
- symbol: EGJ38_RS05130
- product: DUF5011 domain-containing protein
- replicon: chromosome
- strand: -
- coordinates: 1031118..1031435
- length: 318
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NZ_CM129921 (1031118..1031435) NCBI
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301ATGAATAAACTATTACAGTCATTATCAGCCCTCGGTGTTTCTGCTACACTAGTAACACCA
AATTTAAATGCAGATGCAACGACGAATACTACACCACAAATTAAAGGCGCTAATGATATC
GTTATTAAGAAAGGTCAAGATTATAACCTTCTAAACGGCATAAGTGCATTTGATAAAGAA
GATGGAGATTTAACCGATAAAATTAAAGTCGATGGCCAAATTGATACATCTAAATCTGGT
AAATATCAAATTAAATATCATGTCACTGATTCAGATGGTGCAATTAAAATTTCCACTAGG
TATATTGAGGTTAAATAG60
120
180
240
300
318
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: EGJ38_RS05130 [old locus tag: EGJ38_001027 ]
- symbol: EGJ38_RS05130
- description: DUF5011 domain-containing protein
- length: 105
- theoretical pI: 7.5126
- theoretical MW: 11344.7
- GRAVY: -0.431429
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: E-set (CL0159) Bact_surface_Ig-like; Bacterial surface protein, Ig-like domain (PF16403; HMM-score: 83.3)and 6 moreBig_3; Bacterial Ig-like domain (group 3) (PF07523; HMM-score: 20.9)CopC; CopC domain (PF04234; HMM-score: 16.7)Rib; Rib domain (PF08428; HMM-score: 15.9)no clan defined DUF7013; Domain of unknown function (DUF7013) (PF22793; HMM-score: 14.8)E-set (CL0159) DUF4625; Domain of unknown function (DUF4625) (PF15418; HMM-score: 14.4)Big_9; Bacterial Ig domain (PF17963; HMM-score: 14.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 3.33
- Cellwall Score: 3.33
- Extracellular Score: 3.33
- Internal Helices: 0
- DeepLocPro: Extracellular
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 0.0044
- Cell wall & surface Score: 0.0159
- Extracellular Score: 0.9796
- LocateP:
- SignalP: Signal peptide SP(Sec/SPI) length 26 aa
- SP(Sec/SPI): 0.972948
- TAT(Tat/SPI): 0.020365
- LIPO(Sec/SPII): 0.002926
- Cleavage Site: CS pos: 26-27. ADA-TT. Pr: 0.6096
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: WP_001037831 NCBI
- UniProt:
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MNKLLQSLSALGVSATLVTPNLNADATTNTTPQIKGANDIVIKKGQDYNLLNGISAFDKEDGDLTDKIKVDGQIDTSKSGKYQIKYHVTDSDGAIKISTRYIEVK
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: VraR see EGJ38_001027
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]