Jump to navigation
Jump to search
NCBI: 01-DEC-2025
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: EGJ38_001780 [new locus tag: EGJ38_RS08890 ]
- pan locus tag?: SAUPAN004508000
- symbol: rppH
- pan gene symbol?: rppH
- synonym:
- alternate name: JSNZ_001780
- product: RNA deprotection pyrophosphohydrolase
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: EGJ38_001780 [new locus tag: EGJ38_RS08890 ]
- symbol: rppH
- product: RNA deprotection pyrophosphohydrolase
- replicon: chromosome
- strand: -
- coordinates: 1833311..1833784
- length: 474
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq: MGT2423734 NCBI
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421GTGAAGTTTAGGGATAAAGATAATCGTCAAGTTAATTTGACATTTAAAGAGGATAATGAG
ATAGCAGATGGCAATCATGTGCTAGCTATTCCAACGTTTAAAAATCAATTGCTTTTTACC
AAACATAATTTACGGGGTATTGAATTTCCTGGTGGTAAAAGGGAACGCGGGGAAAGTAGT
GCTGAAGCAGTTACCCGTGAATTATATGAAGAAACAGGCGCCAAAGTTAAAAATATTCAT
TACATAGCACAATATACCATTGAAACACATGATCAAACTGATTTTGTAAAAGATGTATAT
TTTATCGAAGTTGAATCATTGGTAAGCAAGAACGATTATTTAGAAACAGCAGGGCCAGTG
TTGTTTAACTGTATCAATGATATTGAACTCGCCCAACGGAGTTTCTTACTGCAAGATAGT
ACTATTTTAAAATGCGTAGAGAGGGTGCAATCACTTGGATTTTATCAAACGTAA60
120
180
240
300
360
420
474
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: EGJ38_001780 [new locus tag: EGJ38_RS08890 ]
- symbol: RppH
- description: RNA deprotection pyrophosphohydrolase
- length: 157
- theoretical pI: 5.06443
- theoretical MW: 18112.2
- GRAVY: -0.494268
⊟Function[edit | edit source]
- TIGRFAM: DNA metabolism DNA replication, recombination, and repair nucleoside triphosphatase YtkD (TIGR02705; EC 3.6.1.-; HMM-score: 228.6)and 2 moreDNA metabolism DNA replication, recombination, and repair mutator mutT protein (TIGR00586; EC 3.6.1.-; HMM-score: 32.4)Unknown function Enzymes of unknown specificity nudix-type nucleoside diphosphatase, YffH/AdpP family (TIGR00052; EC 3.6.1.-; HMM-score: 13.4)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: NUDIX (CL0261) NUDIX; NUDIX domain (PF00293; HMM-score: 44.4)and 6 moreNudt16-like; U8 snoRNA-decapping enzyme-like (PF22327; HMM-score: 17)NUDIX_4; NUDIX domain (PF14815; HMM-score: 14.6)PBP_GOBP (CL0803) Sol_i_2; Ant venom allergen Sol i 2 family (PF22750; HMM-score: 14.5)PDDEXK (CL0236) DUF1064; Protein of unknown function (DUF1064) (PF06356; HMM-score: 13.9)no clan defined LED_rpt; LED repeat (PF20854; HMM-score: 12.2)RepB_primase; RepB DNA-primase N-terminal domain (PF16793; HMM-score: 12)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.918
- Cytoplasmic Membrane Score: 0.0386
- Cell wall & surface Score: 0.0008
- Extracellular Score: 0.0427
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.004352
- TAT(Tat/SPI): 0.000446
- LIPO(Sec/SPII): 0.000498
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: MGT2423734 NCBI
- UniProt:
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MKFRDKDNRQVNLTFKEDNEIADGNHVLAIPTFKNQLLFTKHNLRGIEFPGGKRERGESSAEAVTRELYEETGAKVKNIHYIAQYTIETHDQTDFVKDVYFIEVESLVSKNDYLETAGPVLFNCINDIELAQRSFLLQDSTILKCVERVQSLGFYQT
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- Operon-mapper [1] : EGJ38_001779 < rppH
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
Bioinformatics: 2018, 34(23);4118-4120
[PubMed:29931111] [WorldCat.org] [DOI] (I p)