Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL1841 [new locus tag: SACOL_RS09445 ]
- pan locus tag?: SAUPAN004508000
- symbol: SACOL1841
- pan gene symbol?: rppH
- synonym: ytkD
- product: hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL1841 [new locus tag: SACOL_RS09445 ]
- symbol: SACOL1841
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 1896470..1896949
- length: 480
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3236082 NCBI
- RefSeq: YP_186672 NCBI
- BioCyc: see SACOL_RS09445
- MicrobesOnline: 913285 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421ATGCGCGTGAAGTTTAGGGATAAAGATAATCGTCAAGTTAATTTGACATTTAAAAAGGAT
AATGAGATAGCAGATGGCAATCATGTGCTAGCTATTCCAACGTTTAAAAATCAATTGCTT
TTTACCAAACATAATTTACGGGGGATTGAATTTCCTGGTGGTAAAAGGGAACGCGGGGAA
AGTAGTGCTGAAGCAGTTACACGTGAATTATATGAAGAAACAGGCGCCAAAGTTAAAAAT
ATTTATTACATAGCACAATATACCATTGAAACACATGATCAAACTGATTTTGTAAAAGAT
GTATATTTTATCGAAGTTGAATCATTGGTAAGCAAGAACGATTATTTAGAAACAGCAGGG
CCAGTGTTGTTTAACTGTATCAATGATATTGAACTCGCACAACGGAGTTTCTTACTGCAA
GATAGTACCATTTTAAAATGCGTAGAGAGGGTGCAATCACTTGGGTTTTATCAAACGTAA60
120
180
240
300
360
420
480
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL1841 [new locus tag: SACOL_RS09445 ]
- symbol: SACOL1841
- description: hypothetical protein
- length: 159
- theoretical pI: 5.74715
- theoretical MW: 18392.6
- GRAVY: -0.480503
⊟Function[edit | edit source]
- TIGRFAM: DNA metabolism DNA replication, recombination, and repair nucleoside triphosphatase YtkD (TIGR02705; EC 3.6.1.-; HMM-score: 228.3)and 1 moreDNA metabolism DNA replication, recombination, and repair mutator mutT protein (TIGR00586; EC 3.6.1.-; HMM-score: 31.8)
- TheSEED :
- Low G+C gram positive nudix hydrolase YtkD (EC 3.6.-.-)
- PFAM: NUDIX (CL0261) NUDIX; NUDIX domain (PF00293; HMM-score: 43.1)and 6 moreNudt16-like; U8 snoRNA-decapping enzyme-like (PF22327; HMM-score: 16)PBP_GOBP (CL0803) Sol_i_2; Ant venom allergen Sol i 2 family (PF22750; HMM-score: 14.5)PDDEXK (CL0236) DUF1064; Protein of unknown function (DUF1064) (PF06356; HMM-score: 14)NUDIX (CL0261) NUDIX_4; NUDIX domain (PF14815; HMM-score: 13.9)no clan defined RepB_primase; RepB DNA-primase N-terminal domain (PF16793; HMM-score: 11.9)LED_rpt; LED repeat (PF20854; HMM-score: 11.9)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9086
- Cytoplasmic Membrane Score: 0.0287
- Cell wall & surface Score: 0.0006
- Extracellular Score: 0.0621
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.00507
- TAT(Tat/SPI): 0.000255
- LIPO(Sec/SPII): 0.000552
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MRVKFRDKDNRQVNLTFKKDNEIADGNHVLAIPTFKNQLLFTKHNLRGIEFPGGKRERGESSAEAVTRELYEETGAKVKNIYYIAQYTIETHDQTDFVKDVYFIEVESLVSKNDYLETAGPVLFNCINDIELAQRSFLLQDSTILKCVERVQSLGFYQT
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Cytoplasmic [1] [2] [3]
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p)