From AureoWiki
Jump to navigation Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR3757JSNZ04-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 22-FEB-2026

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: EGJ38_RS01900 [old locus tag: EGJ38_000381 ]
  • pan locus tag?: SAUPAN002160000
  • symbol: EGJ38_RS01900
  • pan gene symbol?: psmα3
  • synonym: psmA3
  • product: phenol-soluble modulin PSM-alpha-3

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: EGJ38_RS01900 [old locus tag: EGJ38_000381 ]
  • symbol: EGJ38_RS01900
  • product: phenol-soluble modulin PSM-alpha-3
  • replicon: chromosome
  • strand: -
  • coordinates: 411840..411908
  • length: 69
  • essential: unknown

⊟Accession numbers[edit | edit source]

  • Location: NZ_CM129921 (411840..411908) NCBI
  • BioCyc:
  • MicrobesOnline:

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    ATGGAATTCGTAGCAAAATTATTCAAATTCTTTAAAGATTTACTTGGTAAATTTTTAGGT
    AACAACTAA
    60
    69


⊟Protein[edit | edit source]

Protein Data Bank: 5I55
Protein Data Bank: 5KGY

⊟General[edit | edit source]

  • locus tag: EGJ38_RS01900 [old locus tag: EGJ38_000381 ]
  • symbol: EGJ38_RS01900
  • description: phenol-soluble modulin PSM-alpha-3
  • length: 22
  • theoretical pI: 10.3333
  • theoretical MW: 2607.13
  • GRAVY: 0.304545

⊟Function[edit | edit source]

  • TIGRFAM:
  • TheSEED:
  • PFAM:
    no clan defined PSMalpha; Phenol-soluble modulin alpha peptide family (PF17063; HMM-score: 43.1)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • DeepLocPro: Extracellular
    • Cytoplasmic Score: 0.0024
    • Cytoplasmic Membrane Score: 0.0033
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.9943
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.189035
    • TAT(Tat/SPI): 0.032224
    • LIPO(Sec/SPII): 0.087963
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

  • GI:
  • RefSeq: WP_014373779 NCBI
  • UniProt:

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MEFVAKLFKFFKDLLGKFLGNN

⊟Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]


⊟Relevant publications[edit | edit source]

Rong Wang, Kevin R Braughton, Dorothee Kretschmer, Thanh-Huy L Bach, Shu Y Queck, Min Li, Adam D Kennedy, David W Dorward, Seymour J Klebanoff, Andreas Peschel, Frank R DeLeo, Michael Otto
Identification of novel cytolytic peptides as key virulence determinants for community-associated MRSA.
Nat Med: 2007, 13(12);1510-4
[PubMed:17994102] [WorldCat.org] [DOI] (I p)
Michael Otto
Staphylococcus aureus toxins.
Curr Opin Microbiol: 2014, 17;32-7
[PubMed:24581690] [WorldCat.org] [DOI] (I p)