From AureoWiki
Jump to: navigation, search
Pangenome04-0298108BA0217611819-97685071193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40

UniProt: 11-DEC-2019

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0493.2
  • pan locus tag?: SAUPAN002160000
  • symbol: psmα3
  • pan gene symbol?: psmα3
  • synonym: psmA3
  • product: Phenol-soluble modulin alpha 3 peptide

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0493.2
  • symbol: psmα3
  • product: Phenol-soluble modulin alpha 3 peptide
  • replicon: chromosome
  • strand: -
  • coordinates: 493035..493103
  • length: 69
  • essential: unknown

Accession numbers[edit source | edit]

  • Gene ID:
  • RefSeq:
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    ATGGAATTCGTAGCAAAATTATTCAAATTCTTTAAAGATTTACTTGGTAAATTTTTAGGT
    AACAACTAA
    60
    69

Protein[edit source | edit]

Protein Data Bank: 5I55
Protein Data Bank: 5KGY

General[edit source | edit]

  • locus tag: SACOL0493.2
  • symbol: Psmα3
  • description: Phenol-soluble modulin alpha 3 peptide
  • length: 22
  • theoretical pI: 10.3333
  • theoretical MW: 2607.13
  • GRAVY: 0.304545

Function[edit source | edit]

  • TIGRFAM:
  • TheSEED:
  • PFAM:

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

Accession numbers[edit source | edit]

  • GI:
  • RefSeq:
  • UniProt: P0C808 UniProt

Protein sequence[edit source | edit]

  • MEFVAKLFKFFKDLLGKFLGNN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • regulator: AgrA (activation) regulon
    AgrA(TF)important in Virulence, Quorum sensing;  [1] [2]

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Shu Y Queck, Max Jameson-Lee, Amer E Villaruz, Thanh-Huy L Bach, Burhan A Khan, Daniel E Sturdevant, Stacey M Ricklefs, Min Li, Michael Otto
    RNAIII-independent target gene control by the agr quorum-sensing system: insight into the evolution of virulence regulation in Staphylococcus aureus.
    Mol. Cell: 2008, 32(1);150-8
    [PubMed:18851841] [WorldCat.org] [DOI] (I p)
  2. Tobias Geiger, Patrice Francois, Manuel Liebeke, Martin Fraunholz, Christiane Goerke, Bernhard Krismer, Jacques Schrenzel, Michael Lalk, Christiane Wolz
    The stringent response of Staphylococcus aureus and its impact on survival after phagocytosis through the induction of intracellular PSMs expression.
    PLoS Pathog.: 2012, 8(11);e1003016
    [PubMed:23209405] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]

Rong Wang, Kevin R Braughton, Dorothee Kretschmer, Thanh-Huy L Bach, Shu Y Queck, Min Li, Adam D Kennedy, David W Dorward, Seymour J Klebanoff, Andreas Peschel, Frank R DeLeo, Michael Otto
Identification of novel cytolytic peptides as key virulence determinants for community-associated MRSA.
Nat. Med.: 2007, 13(12);1510-4
[PubMed:17994102] [WorldCat.org] [DOI] (I p)
Michael Otto
Staphylococcus aureus toxins.
Curr. Opin. Microbiol.: 2014, 17;32-7
[PubMed:24581690] [WorldCat.org] [DOI] (I p)