Jump to navigation
Jump to search
FunGene: 08-OCT-2024
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: JSNZ_000352
- pan locus tag?: SAUPAN002101000
- symbol: JSNZ_000352
- pan gene symbol?: —
- synonym:
- product: DUF1304 domain-containing protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: JSNZ_000352
- symbol: JSNZ_000352
- product: DUF1304 domain-containing protein
- replicon: chromosome
- strand: -
- coordinates: 385636..385995
- length: 360
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq:
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301GTGAATATCATCTCAACAATTTTAATCATATTTGTGGCATTAGAGTTTTTCTATATTATG
TACCTTGAAACGATTGCTACAACTTCCAAAAAGACTAGCGAGACATTTAATATAAGCGTC
GATAAATTGAAAGACAAAAATATTAACCTACTTTTGAAGAACCAAGGCATATATAACGGT
TTAATCGGAATTTTGCTAATATACGGTTTGTTTATCAGCAGTAATCCAAAAGAAATATGC
GCAGCTATTTTAGTGTATATCATTGGCGTTGCTATTTATGGTGGCCTTTCAAGCAATATT
AGTATCTTTTTCAAACAAGGCACATTGCCAGTATTGGCACTCATATCAATGCTTTGGTAA60
120
180
240
300
360
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: JSNZ_000352
- symbol: JSNZ_000352
- description: DUF1304 domain-containing protein
- length: 119
- theoretical pI: 8.98034
- theoretical MW: 13215.8
- GRAVY: 0.907563
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: Hypoth_1 (CL0447) DUF1304; Protein of unknown function (DUF1304) (PF06993; HMM-score: 106.9)and 3 moreno clan defined DUF6249; Domain of unknown function (DUF6249) (PF19762; HMM-score: 15.7)PDDEXK (CL0236) RecU; Recombination protein U (PF03838; HMM-score: 13.2)no clan defined PsiE; Phosphate-starvation-inducible E family (PF06146; HMM-score: 9.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 10
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 3
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.0001
- Cytoplasmic Membrane Score: 0.9851
- Cell wall & surface Score: 0
- Extracellular Score: 0.0148
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.100246
- TAT(Tat/SPI): 0.00038
- LIPO(Sec/SPII): 0.048184
- predicted transmembrane helices (TMHMM): 3
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit | edit source]
- MNIISTILIIFVALEFFYIMYLETIATTSKKTSETFNISVDKLKDKNINLLLKNQGIYNGLIGILLIYGLFISSNPKEICAAILVYIIGVAIYGGLSSNISIFFKQGTLPVLALISMLW
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- Operon-mapper [1] : JSNZ_000352 < JSNZ_000353
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
Bioinformatics: 2018, 34(23);4118-4120
[PubMed:29931111] [WorldCat.org] [DOI] (I p)