Jump to navigation
Jump to search
FunGene: 08-OCT-2024
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: JSNZ_002328
- pan locus tag?: SAUPAN005868000
- symbol: JSNZ_002328
- pan gene symbol?: hrtA
- synonym:
- product: ABC transporter ATP-binding protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: JSNZ_002328
- symbol: JSNZ_002328
- product: ABC transporter ATP-binding protein
- replicon: chromosome
- strand: -
- coordinates: 2325428..2326093
- length: 666
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq:
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661ATGGCATTAGTCGTTAAAGATATCGTCAAAAATTTCGGAGAAGGTTTGTCTGAAACAAAA
GTTTTAAAAGGTATTAATTTTGAAGTGGAACAAGGGGAATTTGTCATTTTAAATGGTGCC
TCTGGTTCTGGGAAAACAACATTGCTAACGATATTAGGCGGATTGTTAAGTCAAACGAGT
GGTACAGTGCTTTACAATGATGCACCATTGTTTGATAAACAGCATCGTCCTAGTGATTTG
CGATTGGAAGATATTGGTTTTATTTTTCAATCTTCACATTTAGTTCCTTATTTAAAAGTG
ATAGAGCAATTGACACTCGTAGGCCAAGAAGCGGGAATGACCAAACAACAAAGTTCAACA
AGAGCAATACAACTTTTGAAAAATATTGGGTTAGAAGATCGCTTGAATGTATATCCGCAT
CAGTTATCTGGCGGTGAAAAGCAACGTGTTGCGATTATGAGAGCATTTATGAATAATCCG
AAAATCATTTTAGCAGATGAGCCCACAGCAAGTTTAGATGCCGATAGAGCAACAAAAGTT
GTTGAGATGATACGTCAACAAATTAAAGAACAACAAATGATTGGTATTATGATTACACAC
GATCGAAGATTATTTGAATATGCAGATCGAGTGATTGAATTAGAAGATGGCAAAATAACT
GATTAG60
120
180
240
300
360
420
480
540
600
660
666
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: JSNZ_002328
- symbol: JSNZ_002328
- description: ABC transporter ATP-binding protein
- length: 221
- theoretical pI: 5.72211
- theoretical MW: 24625.2
- GRAVY: -0.158371
⊟Function[edit | edit source]
- TIGRFAM: ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 212.9)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 199.5)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 175.5)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 175.5)and 77 moreCellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 160)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 156.9)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 155.6)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 144.8)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 140.7)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 139.2)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 135.9)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 134.3)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 131.7)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 131.2)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 126.9)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 121)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 120.5)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 113.7)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 113.7)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 113.3)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 109.9)D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 109.3)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 109.2)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 108.8)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 108.6)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 107.7)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 107.6)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 107.6)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 107.5)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 106.9)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 104.7)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 104.7)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 102.2)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 102.2)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 101.6)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 97.5)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 97.1)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 96.9)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 93.4)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 91.4)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 89.1)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 89.1)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 88.8)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 88.8)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 88.7)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 86.6)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 85.6)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 85.4)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 85.2)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 83.3)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 83.3)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 83.3)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 81.3)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 78.8)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 78.8)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 76.9)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 76.9)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 76.9)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 75.8)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 71)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 71)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 69.8)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 65.6)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 63.2)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 59.8)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 56.7)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 48.2)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 43.6)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 42)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 37.2)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 36.7)Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions dTMP kinase (TIGR00041; EC 2.7.4.9; HMM-score: 21.5)helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 19.1)Cellular processes Cell division chromosome segregation protein SMC (TIGR02169; HMM-score: 18.9)DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02169; HMM-score: 18.9)rad50 (TIGR00606; HMM-score: 18.7)Purines, pyrimidines, nucleosides, and nucleotides Salvage of nucleosides and nucleotides uridine kinase (TIGR00235; EC 2.7.1.48; HMM-score: 15.2)Protein synthesis tRNA and rRNA base modification tRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 13.7)DNA metabolism Restriction/modification DNA sulfur modification protein DndD (TIGR03185; HMM-score: 12.5)P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 12.3)type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 10.7)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 118.1)and 25 moreSMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 37.3)AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 25.5)CbiA; CobQ/CobB/MinD/ParA nucleotide binding domain (PF01656; HMM-score: 25.3)AAA_16; AAA ATPase domain (PF13191; HMM-score: 21.7)AAA_13; AAA domain (PF13166; HMM-score: 18.7)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 18.3)AAA_18; AAA domain (PF13238; HMM-score: 17.6)AAA_22; AAA domain (PF13401; HMM-score: 17.5)nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 16.9)AAA_25; AAA domain (PF13481; HMM-score: 16.7)NACHT; NACHT domain (PF05729; HMM-score: 15.1)AAA_30; AAA domain (PF13604; HMM-score: 14.2)CPT; Chloramphenicol phosphotransferase-like protein (PF07931; HMM-score: 14)TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 13.8)SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 13.3)AAA_23; AAA domain (PF13476; HMM-score: 13.1)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 13)cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 12.9)AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 12.8)AAA_33; AAA domain (PF13671; HMM-score: 12.8)nSTAND1; Novel STAND NTPase 1 (PF20703; HMM-score: 12.6)GvpD_P-loop; GvpD gas vesicle protein, P-loop domain (PF07088; HMM-score: 12.5)Zeta_toxin; Zeta toxin (PF06414; HMM-score: 12.4)AAA_28; AAA domain (PF13521; HMM-score: 11.2)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 9.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.04
- Cytoplasmic Membrane Score: 9.96
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 0
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.174
- Cytoplasmic Membrane Score: 0.8181
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.0077
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.011471
- TAT(Tat/SPI): 0.000817
- LIPO(Sec/SPII): 0.00056
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit | edit source]
- MALVVKDIVKNFGEGLSETKVLKGINFEVEQGEFVILNGASGSGKTTLLTILGGLLSQTSGTVLYNDAPLFDKQHRPSDLRLEDIGFIFQSSHLVPYLKVIEQLTLVGQEAGMTKQQSSTRAIQLLKNIGLEDRLNVYPHQLSGGEKQRVAIMRAFMNNPKIILADEPTASLDADRATKVVEMIRQQIKEQQMIGIMITHDRRLFEYADRVIELEDGKITD
⊟Experimental data[edit | edit source]
- experimentally validated: data available for NCTC8325
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- Operon-mapper [1] : JSNZ_002328 < JSNZ_002329
⊟Regulation[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
Bioinformatics: 2018, 34(23);4118-4120
[PubMed:29931111] [WorldCat.org] [DOI] (I p) - ↑ Hannes Wolfgramm, Larissa Milena Busch, Jöran Tebben, Henry Mehlan, Lisa Hagenau, Thomas Sura, Tilly Hoffmüller, Elisa Bludau, Manuela Gesell Salazar, Alexander Reder, Stephan Michalik, Leif Steil, Kristin Surmann, Ulrike Mäder, Silva Holtfreter, Uwe Völker
Integrated genomic and proteomic analysis of the mouse-adapted Staphylococcus aureus strain JSNZ.
Curr Res Microb Sci: 2025, 9;100489
[PubMed:41146725] [WorldCat.org] [DOI] (I e)