From AureoWiki
Jump to navigation Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

UniProt: 26-FEB-2020

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0417.1
  • pan locus tag?: SAUPAN002159000
  • symbol: psmα4
  • pan gene symbol?: psmα4
  • synonym: psmA4
  • product: Phenol-soluble modulin alpha 4 peptide

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_0417.1
  • symbol: psmα4
  • product: Phenol-soluble modulin alpha 4 peptide
  • replicon: chromosome
  • strand: -
  • coordinates: 466249..466311
  • length: 63
  • essential: unknown

Accession numbers[edit | edit source]

  • Gene ID:
  • RefSeq:
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    ATGGCTATTGTAGGTACTATCATTAAAATCATCAAAGCAATTATCGACATTTTCGCAAAA
    TAA
    60
    63

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_0417.1
  • symbol: Psmα4
  • description: Phenol-soluble modulin alpha 4 peptide
  • length: 20
  • theoretical pI: 10.5069
  • theoretical MW: 2171.78
  • GRAVY: 1.7

Function[edit | edit source]

  • TIGRFAM:
  • TheSEED:
  • PFAM:

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt: P0C822 UniProt

Protein sequence[edit | edit source]

  • MAIVGTIIKIIKAIIDIFAK

Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator: AgrA (activation) regulon
    AgrA(TF)important in Virulence, Quorum sensing;  [1] [2]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Shu Y Queck, Max Jameson-Lee, Amer E Villaruz, Thanh-Huy L Bach, Burhan A Khan, Daniel E Sturdevant, Stacey M Ricklefs, Min Li, Michael Otto
    RNAIII-independent target gene control by the agr quorum-sensing system: insight into the evolution of virulence regulation in Staphylococcus aureus.
    Mol Cell: 2008, 32(1);150-8
    [PubMed:18851841] [WorldCat.org] [DOI] (I p)
  2. Tobias Geiger, Patrice Francois, Manuel Liebeke, Martin Fraunholz, Christiane Goerke, Bernhard Krismer, Jacques Schrenzel, Michael Lalk, Christiane Wolz
    The stringent response of Staphylococcus aureus and its impact on survival after phagocytosis through the induction of intracellular PSMs expression.
    PLoS Pathog: 2012, 8(11);e1003016
    [PubMed:23209405] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]

Rong Wang, Kevin R Braughton, Dorothee Kretschmer, Thanh-Huy L Bach, Shu Y Queck, Min Li, Adam D Kennedy, David W Dorward, Seymour J Klebanoff, Andreas Peschel, Frank R DeLeo, Michael Otto
Identification of novel cytolytic peptides as key virulence determinants for community-associated MRSA.
Nat Med: 2007, 13(12);1510-4
[PubMed:17994102] [WorldCat.org] [DOI] (I p)
Michael Otto
Staphylococcus aureus toxins.
Curr Opin Microbiol: 2014, 17;32-7
[PubMed:24581690] [WorldCat.org] [DOI] (I p)