From AureoWiki
Jump to navigation Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

UniProt: 05-OCT-2016

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00411.1
  • pan locus tag?: SAUPAN002159000
  • symbol: psmα4
  • pan gene symbol?: psmα4
  • synonym: psmA4
  • product: Phenol-soluble modulin alpha 4 peptide

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_00411.1
  • symbol: psmα4
  • product: Phenol-soluble modulin alpha 4 peptide
  • replicon: chromosome
  • strand: -
  • coordinates: 412583..412645
  • length: 63
  • essential: unknown

⊟Accession numbers[edit | edit source]

  • Gene ID:
  • RefSeq:
  • BioCyc: G1I0R-3541 BioCyc
  • MicrobesOnline:

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    ATGGCTATTGTAGGTACTATCATTAAAATCATCAAAGCAATTATCGACATTTTCGCAAAA
    TAA
    60
    63

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SAOUHSC_00411.1
  • symbol: Psmα4
  • description: Phenol-soluble modulin alpha 4 peptide
  • length: 20
  • theoretical pI: 10.5069
  • theoretical MW: 2171.78
  • GRAVY: 1.7

⊟Function[edit | edit source]

  • TIGRFAM:
  • TheSEED:
  • PFAM:
    no clan defined Psm4; Phenol-soluble modulin alpha 4 peptide (PF17063; HMM-score: 42.1)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.149845
    • TAT(Tat/SPI): 0.023076
    • LIPO(Sec/SPII): 0.097562
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

  • GI: 206557899 NCBI
  • RefSeq:
  • UniProt: P0C818 UniProt
  • STRING:

⊟Protein sequence[edit | edit source]

  • MAIVGTIIKIIKAIIDIFAK

⊟Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator: AgrA* (activation) regulon
    AgrA*(TF)important in Virulence, Quorum sensing;  [1] [2]

⊟Transcription pattern[edit | edit source]

  • S.aureus Expression Data Browser:  [3] The transcript corresponding to psmα1-4 mRNA was identified as new RNA feature (S130) in [3] because the psmα-genes are not covered by the RefSeq annotation.
    Expression Data Browser
    Multi-gene expression profiles

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Shu Y Queck, Max Jameson-Lee, Amer E Villaruz, Thanh-Huy L Bach, Burhan A Khan, Daniel E Sturdevant, Stacey M Ricklefs, Min Li, Michael Otto
    RNAIII-independent target gene control by the agr quorum-sensing system: insight into the evolution of virulence regulation in Staphylococcus aureus.
    Mol Cell: 2008, 32(1);150-8
    [PubMed:18851841] [WorldCat.org] [DOI] (I p)
  2. ↑ Tobias Geiger, Patrice Francois, Manuel Liebeke, Martin Fraunholz, Christiane Goerke, Bernhard Krismer, Jacques Schrenzel, Michael Lalk, Christiane Wolz
    The stringent response of Staphylococcus aureus and its impact on survival after phagocytosis through the induction of intracellular PSMs expression.
    PLoS Pathog: 2012, 8(11);e1003016
    [PubMed:23209405] [WorldCat.org] [DOI] (I p)
  3. ↑ 3.0 3.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

⊟Relevant publications[edit | edit source]

Rong Wang, Kevin R Braughton, Dorothee Kretschmer, Thanh-Huy L Bach, Shu Y Queck, Min Li, Adam D Kennedy, David W Dorward, Seymour J Klebanoff, Andreas Peschel, Frank R DeLeo, Michael Otto
Identification of novel cytolytic peptides as key virulence determinants for community-associated MRSA.
Nat Med: 2007, 13(12);1510-4
[PubMed:17994102] [WorldCat.org] [DOI] (I p)Michael Otto
Staphylococcus aureus toxins.
Curr Opin Microbiol: 2014, 17;32-7
[PubMed:24581690] [WorldCat.org] [DOI] (I p)

Retrieved from "http://aureowiki.med.uni-greifswald.de/index.php?title=SAOUHSC_00411.1&oldid=102389"