From AureoWiki
Jump to: navigation, search

NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0787 [new locus tag: NWMN_RS04450 ]
  • pan locus tag?: SAUPAN002897000
  • symbol: sufS
  • pan gene symbol?: sufS
  • synonym:
  • product: cysteine desulfurase SufS subfamily protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0787 [new locus tag: NWMN_RS04450 ]
  • symbol: sufS
  • product: cysteine desulfurase SufS subfamily protein
  • replicon: chromosome
  • strand: +
  • coordinates: 876694..877944
  • length: 1251
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    GTGAATGAAGTGGCCGAACACTCATTTGACGTTAATGAAGTAATCAAGGATTTTCCGATA
    TTAGATCAAAAAGTCAATGGCAAACGTTTAGCATATCTTGATTCAACAGCGACAAGTCAA
    ACGCCTGTGCAAGTGTTAAATGTTTTAGAAGATTACTACAAGCGTTATAATTCAAACGTT
    CATCGTGGTGTTCATACATTAGGATCATTGGCAACTGATGGTTATGAAAATGCCCGTGAA
    ACCGTTCGTCGTTTTATTAATGCGAAGTATTTTGAAGAAATCATTTTTACACGCGGAACA
    ACTGCGTCGATTAACCTTGTAGCACATAGCTATGGTGATGCAAATGTTGAAGAGGGCGAT
    GAAATTGTTGTCACTGAAATGGAACATCATGCCAATATTGTTCCTTGGCAACAGTTAGCA
    AAGCGTAAAAATGCGACATTGAAATTTATACCAATGACAGCTGACGGTGAATTAAACATC
    GAGGATATTAAGCAAACGATTAATGATAAAACAAAGATCGTTGCTATTGCACATATATCT
    AATGTGCTCGGTACAATTAATGATGTTAAAACCATTGCAGAAATAGCTCATCAACATGGT
    GCAATTATCAGTGTTGATGGGGCGCAAGCAGCACCACATATGAAACTTGATATGCAAGAA
    ATGAATGCTGATTTTTATAGTTTTAGTGGTCATAAAATGCTTGGACCAACAGGTATTGGC
    GTATTATTTGGTAAACGTGAGTTACTACAAAAAATGGAACCGATTGAGTTCGGTGGCGAC
    ATGATTGATTTTGTAAGTAAGTATGATGCAACATGGGCTGATTTACCTACTAAATTTGAG
    GCGGGTACTCCATTAATTGCTCAAGCAATTGGGCTTGCAGAAGCTATTCGCTATTTAGAA
    CGCATAGGTTTTGATGCAATTCATAAATATGAACAAGAATTAACGATATATGCTTATGAG
    CAAATGTCTGCAATTGAAGGAATTGAAATTTATGGCCCGCCAAAGGATCGTCGTGCAGGT
    GTAATAACGTTTAATTTACAAGATGTACATCCACACGATGTTGCTACAGCCGTAGATACA
    GAAGGTGTAGCGGTTAGAGCTGGGCATCATTGTGCGCAACCGTTAATGAAATGGTTAAAT
    GTGTCTTCAACAGCTAGAGCGAGTTTTTATATATACAACACGAAAGAAGACGTTGATCAG
    TTAATAAATGCCTTGAAACAAACGAAGGAGTTTTTCTCTTATGAATTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1251

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_0787 [new locus tag: NWMN_RS04450 ]
  • symbol: SufS
  • description: cysteine desulfurase SufS subfamily protein
  • length: 416
  • theoretical pI: 5.18484
  • theoretical MW: 46618.4
  • GRAVY: -0.257933

Function[edit source | edit]

  • reaction:
    EC 2.8.1.7?  ExPASy
    Cysteine desulfuraseL-cysteine + acceptor = L-alanine + S-sulfanyl-acceptor
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercysteine desulfurase, SufS family (TIGR01979; HMM-score: 614.9)
    and 33 more
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercysteine desulfurase, catalytic subunit CsdA (TIGR03392; EC 2.8.1.7; HMM-score: 385.1)
    Unknown functionEnzymes of unknown specificitycysteine desulfurase family protein (TIGR01976; HMM-score: 260.8)
    Unknown functionEnzymes of unknown specificitycysteine desulfurase family protein (TIGR01977; HMM-score: 251)
    cysteine desulfurase NifS (TIGR03402; EC 2.8.1.7; HMM-score: 167.4)
    Genetic information processingDNA metabolismRestriction/modificationcysteine desulfurase DndA (TIGR03235; EC 2.8.1.7; HMM-score: 144.7)
    Genetic information processingProtein synthesistRNA and rRNA base modificationcysteine desulfurase IscS (TIGR02006; EC 2.8.1.7; HMM-score: 135.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercysteine desulfurase IscS (TIGR02006; EC 2.8.1.7; HMM-score: 135.9)
    cysteine desulfurase, NifS family (TIGR03403; EC 2.8.1.7; HMM-score: 119.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersGlutathione and analogsergothioneine biosynthesis PLP-dependent enzyme EgtE (TIGR04343; EC 4.4.-.-; HMM-score: 70.6)
    2-aminoethylphosphonate aminotransferase (TIGR03301; EC 2.6.1.-; HMM-score: 42.9)
    O-phospho-L-seryl-tRNA:Cys-tRNA synthase (TIGR02539; EC 2.5.1.73; HMM-score: 41.7)
    MetabolismEnergy metabolismAmino acids and amineskynureninase (TIGR01814; EC 3.7.1.3; HMM-score: 33.3)
    MetabolismAmino acid biosynthesisAspartate familyO-succinylhomoserine sulfhydrylase (TIGR01325; EC 4.2.99.-; HMM-score: 33.1)
    MetabolismEnergy metabolismAmino acids and aminesmethionine gamma-lyase (TIGR01328; EC 4.4.1.11; HMM-score: 33)
    MetabolismCentral intermediary metabolismPhosphorus compounds2-aminoethylphosphonate--pyruvate transaminase (TIGR02326; EC 2.6.1.37; HMM-score: 31.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthertyrosine decarboxylase MnfA (TIGR03812; EC 4.1.1.25; HMM-score: 30.8)
    MetabolismAmino acid biosynthesisAspartate familyO-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase (TIGR01326; HMM-score: 27.5)
    MetabolismAmino acid biosynthesisSerine familyO-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase (TIGR01326; HMM-score: 27.5)
    MetabolismAmino acid biosynthesisAspartate familyO-succinylhomoserine (thiol)-lyase (TIGR02080; EC 2.5.1.48; HMM-score: 27.2)
    Genetic information processingProtein synthesistRNA aminoacylationL-seryl-tRNA(Sec) selenium transferase (TIGR00474; EC 2.9.1.1; HMM-score: 25.6)
    Cellular processesCellular processesBiosynthesis of natural productscapreomycidine synthase (TIGR03947; HMM-score: 25.2)
    MetabolismAmino acid biosynthesisHistidine familyhistidinol-phosphate transaminase (TIGR01141; EC 2.6.1.9; HMM-score: 23)
    cystathionine beta-lyase (TIGR01329; EC 4.4.1.8; HMM-score: 22.5)
    putative pyridoxal phosphate-dependent acyltransferase (TIGR01825; EC 2.3.1.-; HMM-score: 22)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesTDP-4-keto-6-deoxy-D-glucose transaminase (TIGR02379; HMM-score: 21)
    MetabolismAmino acid biosynthesisAspartate familycystathionine beta-lyase (TIGR01324; EC 4.4.1.8; HMM-score: 18)
    MetabolismEnergy metabolismAmino acids and aminestyrosine aminotransferase (TIGR01264; EC 2.6.1.5; HMM-score: 16.4)
    UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase (TIGR03588; EC 2.6.1.92; HMM-score: 16)
    MetabolismEnergy metabolismAmino acids and aminesglycine C-acetyltransferase (TIGR01822; EC 2.3.1.29; HMM-score: 15.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersBiotin8-amino-7-oxononanoate synthase (TIGR00858; EC 2.3.1.47; HMM-score: 15.1)
    Unknown functionEnzymes of unknown specificitypyridoxal phosphate enzyme, MJ0158 family (TIGR03576; HMM-score: 15)
    tyrosine/nicotianamine family aminotransferase (TIGR01265; HMM-score: 14.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalamin5-aminolevulinic acid synthase (TIGR01821; EC 2.3.1.37; HMM-score: 14)
  • TheSEED:  
    Amino Acids and DerivativesAlanine, serine, and glycineAlanine biosynthesis Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
    and 4 more
    Clustering-based subsystemsCell DivisionCBSS-393130.3.peg.794 Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
    RNA MetabolismRNA processing and modificationtRNA modification Archaea Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
    tRNA mods Archaea Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
    Sulfur MetabolismOrganic sulfur assimilationAt5g37530 (CsdL protein family) Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
  • PFAM:
    PLP_aminotran (CL0061) Aminotran_5; Aminotransferase class-V (PF00266; HMM-score: 537.3)
    and 6 more
    Cys_Met_Meta_PP; Cys/Met metabolism PLP-dependent enzyme (PF01053; HMM-score: 44.4)
    DegT_DnrJ_EryC1; DegT/DnrJ/EryC1/StrS aminotransferase family (PF01041; HMM-score: 37.2)
    Aminotran_1_2; Aminotransferase class I and II (PF00155; HMM-score: 36.3)
    Beta_elim_lyase; Beta-eliminating lyase (PF01212; HMM-score: 32.5)
    SelA; L-seryl-tRNA selenium transferase (PF03841; HMM-score: 21.3)
    Pyridoxal_deC; Pyridoxal-dependent decarboxylase conserved domain (PF00282; HMM-score: 16.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: pyridoxal 5'-phosphate
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.006062
    • TAT(Tat/SPI): 0.000698
    • LIPO(Sec/SPII): 0.001239
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNEVAEHSFDVNEVIKDFPILDQKVNGKRLAYLDSTATSQTPVQVLNVLEDYYKRYNSNVHRGVHTLGSLATDGYENARETVRRFINAKYFEEIIFTRGTTASINLVAHSYGDANVEEGDEIVVTEMEHHANIVPWQQLAKRKNATLKFIPMTADGELNIEDIKQTINDKTKIVAIAHISNVLGTINDVKTIAEIAHQHGAIISVDGAQAAPHMKLDMQEMNADFYSFSGHKMLGPTGIGVLFGKRELLQKMEPIEFGGDMIDFVSKYDATWADLPTKFEAGTPLIAQAIGLAEAIRYLERIGFDAIHKYEQELTIYAYEQMSAIEGIEIYGPPKDRRAGVITFNLQDVHPHDVATAVDTEGVAVRAGHHCAQPLMKWLNVSSTARASFYIYNTKEDVDQLINALKQTKEFFSYEF

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • regulator: PerR* (repression) regulon
    PerR(TF)important in Oxidative stress response; RegPrecise    transcription unit transferred from N315 data RegPrecise  

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]