From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0776 [new locus tag: SA_RS04430 ]
  • pan locus tag?: SAUPAN002897000
  • symbol: SA0776
  • pan gene symbol?: sufS
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA0776 [new locus tag: SA_RS04430 ]
  • symbol: SA0776
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 882392..883633
  • length: 1242
  • essential: yes DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    GTGGCCGAACACTCATTTGACGTTAATGAAGTAATCAAGGATTTTCCGATATTAGATCAA
    AAAGTCAATGGCAAACGTTTAGCATATCTTGATTCAACAGCGACAAGTCAAACGCCTATG
    CAAGTGTTAAATGTTTTAGAGGATTACTACAAGCGTTATAATTCAAACGTTCATCGTGGT
    GTTCATACATTAGGATCATTGGCAACTGATGGTTATGAAAATGCCCGTGAAACCGTTCGT
    CGTTTTATTAATGCGAAGTATTTTGAAGAAATCATTTTCACACGCGGAACAACTGCGTCG
    ATTAACCTTGTAGCACATAGCTATGGTGATGCAAATGTTGAAGAGGGCGATGAAATTGTT
    GTCACTGAAATGGAGCATCATGCCAATATTGTTCCTTGGCAACAGTTAGCAAAGCGTAAA
    AATGCGACATTGAAATTTATACCAATGACAGCTGACGGTGAATTAAACATCGAAGATATT
    AAGCAAACGATTAATGATAAAACAAAGATCGTTGCTATTGCACATATTTCTAATGTACTC
    GGTACAATTAATGATGTTAAAACCATTGCAGAAATAGCTCATCAACATGGCGCAATTATC
    AGTGTTGATGGGGCGCAAGCAGCACCACATATGAAACTTGATATGCAAGAAATGAATGCT
    GATTTTTATAGTTTTAGTGGTCATAAAATGCTTGGACCAACAGGTATTGGCGTATTATTT
    GGTAAACGTGAGTTACTACAAAAAATGGAACCGATTGAGTTCGGTGGTGACATGATTGAT
    TTTGTAAGTAAGTATGATGCAACATGGGCTGATTTACCTACTAAATTTGAGGCGGGTACT
    CCATTAATTGCTCAAGCAATTGGGCTTGCAGAAGCTATTCGCTATTTAGAACGCATAGGT
    TTTGATGCAATTCATAAATATGAACAAGAATTAACGATATATGCTTATGAGCAAATGTCT
    GCAATTGAAGGAATTGAAATTTATGGCCCGCCTAAGGATCGTCGTGCAGGTGTAATAACG
    TTTAATTTACAAGATGTACATCCACACGATGTTGCTACAGCCGTAGATACAGAAGGTGTA
    GCGGTTAGAGCTGGGCATCATTGTGCGCAACCGTTAATGAAATGGTTAAATGTGTCTTCA
    ACAGCTAGAGCGAGTTTTTATATATACAACACGAAAGAAGACATTGATCAGTTAATAAAT
    GCCTTGAAACAAACGAAGGAGTTTTTCTCTTATGAATTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1242

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA0776 [new locus tag: SA_RS04430 ]
  • symbol: SA0776
  • description: hypothetical protein
  • length: 413
  • theoretical pI: 5.28844
  • theoretical MW: 46322.1
  • GRAVY: -0.257869

Function[edit | edit source]

  • reaction:
    EC 2.8.1.7?  ExPASy
    Cysteine desulfurase L-cysteine + acceptor = L-alanine + S-sulfanyl-acceptor
  • TIGRFAM:
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other cysteine desulfurase, SufS family (TIGR01979; HMM-score: 615.7)
    and 33 more
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other cysteine desulfurase, catalytic subunit CsdA (TIGR03392; EC 2.8.1.7; HMM-score: 384.6)
    Unknown function Enzymes of unknown specificity cysteine desulfurase family protein (TIGR01976; HMM-score: 261)
    Unknown function Enzymes of unknown specificity cysteine desulfurase family protein (TIGR01977; HMM-score: 251.8)
    cysteine desulfurase NifS (TIGR03402; EC 2.8.1.7; HMM-score: 168)
    Genetic information processing DNA metabolism Restriction/modification cysteine desulfurase DndA (TIGR03235; EC 2.8.1.7; HMM-score: 145.1)
    Genetic information processing Protein synthesis tRNA and rRNA base modification cysteine desulfurase IscS (TIGR02006; EC 2.8.1.7; HMM-score: 136.3)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other cysteine desulfurase IscS (TIGR02006; EC 2.8.1.7; HMM-score: 136.3)
    cysteine desulfurase, NifS family (TIGR03403; EC 2.8.1.7; HMM-score: 120.3)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Glutathione and analogs ergothioneine biosynthesis PLP-dependent enzyme EgtE (TIGR04343; EC 4.4.-.-; HMM-score: 71.1)
    2-aminoethylphosphonate aminotransferase (TIGR03301; EC 2.6.1.-; HMM-score: 43.1)
    O-phospho-L-seryl-tRNA:Cys-tRNA synthase (TIGR02539; EC 2.5.1.73; HMM-score: 41.6)
    Metabolism Energy metabolism Amino acids and amines methionine gamma-lyase (TIGR01328; EC 4.4.1.11; HMM-score: 33.2)
    Metabolism Energy metabolism Amino acids and amines kynureninase (TIGR01814; EC 3.7.1.3; HMM-score: 33.2)
    Metabolism Amino acid biosynthesis Aspartate family O-succinylhomoserine sulfhydrylase (TIGR01325; EC 4.2.99.-; HMM-score: 33.1)
    Metabolism Central intermediary metabolism Phosphorus compounds 2-aminoethylphosphonate--pyruvate transaminase (TIGR02326; EC 2.6.1.37; HMM-score: 31.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other tyrosine decarboxylase MnfA (TIGR03812; EC 4.1.1.25; HMM-score: 31.3)
    Metabolism Amino acid biosynthesis Aspartate family O-succinylhomoserine (thiol)-lyase (TIGR02080; EC 2.5.1.48; HMM-score: 27.7)
    Metabolism Amino acid biosynthesis Aspartate family O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase (TIGR01326; HMM-score: 27.5)
    Metabolism Amino acid biosynthesis Serine family O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase (TIGR01326; HMM-score: 27.5)
    Genetic information processing Protein synthesis tRNA aminoacylation L-seryl-tRNA(Sec) selenium transferase (TIGR00474; EC 2.9.1.1; HMM-score: 25.6)
    Cellular processes Cellular processes Biosynthesis of natural products capreomycidine synthase (TIGR03947; HMM-score: 25.3)
    Metabolism Amino acid biosynthesis Histidine family histidinol-phosphate transaminase (TIGR01141; EC 2.6.1.9; HMM-score: 23)
    cystathionine beta-lyase (TIGR01329; EC 4.4.1.8; HMM-score: 22.5)
    putative pyridoxal phosphate-dependent acyltransferase (TIGR01825; EC 2.3.1.-; HMM-score: 21.1)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides TDP-4-keto-6-deoxy-D-glucose transaminase (TIGR02379; HMM-score: 21)
    Metabolism Amino acid biosynthesis Aspartate family cystathionine beta-lyase (TIGR01324; EC 4.4.1.8; HMM-score: 18)
    Metabolism Energy metabolism Amino acids and amines tyrosine aminotransferase (TIGR01264; EC 2.6.1.5; HMM-score: 16.4)
    UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase (TIGR03588; EC 2.6.1.92; HMM-score: 16)
    Metabolism Energy metabolism Amino acids and amines glycine C-acetyltransferase (TIGR01822; EC 2.3.1.29; HMM-score: 15.3)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Biotin 8-amino-7-oxononanoate synthase (TIGR00858; EC 2.3.1.47; HMM-score: 15.2)
    Unknown function Enzymes of unknown specificity pyridoxal phosphate enzyme, MJ0158 family (TIGR03576; HMM-score: 15)
    tyrosine/nicotianamine family aminotransferase (TIGR01265; HMM-score: 14.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin 5-aminolevulinic acid synthase (TIGR01821; EC 2.3.1.37; HMM-score: 14.1)
  • TheSEED:  
    Amino Acids and Derivatives Alanine, serine, and glycine Alanine biosynthesis  Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
    and 4 more
    Clustering-based subsystems Cell Division CBSS-393130.3.peg.794  Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
    RNA Metabolism RNA processing and modification tRNA modification Archaea  Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
    tRNA mods Archaea  Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
    Sulfur Metabolism Organic sulfur assimilation At5g37530 (CsdL protein family)  Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
  • PFAM:
    PLP_aminotran (CL0061) Aminotran_5; Aminotransferase class-V (PF00266; HMM-score: 537)
    and 6 more
    Cys_Met_Meta_PP; Cys/Met metabolism PLP-dependent enzyme (PF01053; HMM-score: 44.4)
    DegT_DnrJ_EryC1; DegT/DnrJ/EryC1/StrS aminotransferase family (PF01041; HMM-score: 37.2)
    Aminotran_1_2; Aminotransferase class I and II (PF00155; HMM-score: 36.2)
    Beta_elim_lyase; Beta-eliminating lyase (PF01212; HMM-score: 32.5)
    SelA; L-seryl-tRNA selenium transferase (PF03841; HMM-score: 21.3)
    Pyridoxal_deC; Pyridoxal-dependent decarboxylase conserved domain (PF00282; HMM-score: 17)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: pyridoxal 5'-phosphate
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.004569
    • TAT(Tat/SPI): 0.000381
    • LIPO(Sec/SPII): 0.000486
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MAEHSFDVNEVIKDFPILDQKVNGKRLAYLDSTATSQTPMQVLNVLEDYYKRYNSNVHRGVHTLGSLATDGYENARETVRRFINAKYFEEIIFTRGTTASINLVAHSYGDANVEEGDEIVVTEMEHHANIVPWQQLAKRKNATLKFIPMTADGELNIEDIKQTINDKTKIVAIAHISNVLGTINDVKTIAEIAHQHGAIISVDGAQAAPHMKLDMQEMNADFYSFSGHKMLGPTGIGVLFGKRELLQKMEPIEFGGDMIDFVSKYDATWADLPTKFEAGTPLIAQAIGLAEAIRYLERIGFDAIHKYEQELTIYAYEQMSAIEGIEIYGPPKDRRAGVITFNLQDVHPHDVATAVDTEGVAVRAGHHCAQPLMKWLNVSSTARASFYIYNTKEDIDQLINALKQTKEFFSYEF

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: PerR* (repression) regulon
    PerR(TF)important in Oxidative stress response; RegPrecise  

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]

Alexander Scherl, Patrice François, Manuela Bento, Jacques M Deshusses, Yvan Charbonnier, Véronique Converset, Antoine Huyghe, Nadia Walter, Christine Hoogland, Ron D Appel, Jean-Charles Sanchez, Catherine G Zimmermann-Ivol, Garry L Corthals, Denis F Hochstrasser, Jacques Schrenzel
Correlation of proteomic and transcriptomic profiles of Staphylococcus aureus during the post-exponential phase of growth.
J Microbiol Methods: 2005, 60(2);247-57
[PubMed:15590099] [WorldCat.org] [DOI] (P p)