From AureoWiki
Jump to navigation Jump to search

NCBI: 06-JUL-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1209 [new locus tag: NWMN_RS06800 ]
  • pan locus tag?: SAUPAN003613000
  • symbol: glpD
  • pan gene symbol?: glpD
  • synonym:
  • product: aerobic glycerol-3-phosphate dehydrogenase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_1209 [new locus tag: NWMN_RS06800 ]
  • symbol: glpD
  • product: aerobic glycerol-3-phosphate dehydrogenase
  • replicon: chromosome
  • strand: +
  • coordinates: 1334843..1336564
  • length: 1722
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    ATGTGGGACAAGTCTCTCGTTTTTACATTTTTTAGGAGGCGTTTTGGAATGGCATTGTCT
    ACTTTTAAGAGAGAACATATTAAAAAGAATTTAAGAAATGATGAATATGATTTAGTAATT
    ATTGGTGGCGGTATTACAGGTGCAGGTATTGCACTAGACGCGAGTGAAAGAGGAATGAAA
    GTTGCATTAGTTGAAATGCAAGACTTTGCACAAGGAACAAGCTCAAGATCTACAAAATTA
    GTCCATGGTGGTTTGCGTTACTTAAAACAATTCCAAATTGGAGTAGTTGCCGAAACTGGT
    AAAGAACGTGCGATTGTTTATGAAAATGGGCCTCATGTTACGACTCCAGAGTGGATGCTT
    TTACCAATGCATAAAGGTGGAACATTTGGTAAATTCTCAACATCAATTGGTTTAGGAATG
    TATGATCGTTTAGCAGGTGTTAAGAAGTCTGAACGTAAAAAAATGTTATCTAAAAAAGAA
    ACTTTAGCTAAAGAACCATTAGTTAAAAAAGAAGGTCTAAAAGGCGGCGGTTACTATGTT
    GAATATCGTACTGACGATGCGCGTTTAACTATTGAAGTTATGAAGCGTGCTGCTGAAAAA
    GGCGCAGAAATTATCAACTATACTAAATCTGAACACTTCACTTATGATAAAAATCAACAA
    GTAAATGGTGTTAAAGTTATAGATAAATTAACTAATGAAAATTATACAATTAAGGCTAAA
    AAAGTGGTTAATGCAGCAGGTCCATGGGTTGATGATGTTAGAAGTGGTGATTATGCACGC
    AATAATAAAAAATTACGTTTAACTAAAGGTGTACATGTTGTTATTGATCAATCAAAATTC
    CCATTAGGTCAAGCAGTATACTTTGATACTGAAAAAGATGGAAGAATGATTTTTGCAATT
    CCACGTGAAGGAAAAGTGTATGTAGGTACTACAGATACATTCTATGACAATATCAAATCT
    TCACCATTAACTACACAAGAAGACAGAGACTATTTAATCGATGCGATTAATTACATGTTC
    CCTAGTGTTAATGTTACAGATGAAGATATTGAATCAACATGGGCAGGAATTAGACCATTA
    ATTTACGAAGAAGGCAAAGACCCTTCTGAAATCTCTCGTAAGGATGAAATTTGGGAAGGT
    AAATCAGGTTTATTAACTATTGCAGGTGGTAAATTAACAGGCTATCGTCACATGGCTCAA
    GACATTGTTGATTTAGTATCTAAACGCTTGAAAAAAGACTACGGTTTAACATTTAGTCCA
    TGTAATACAAAAGGTCTGGCAATTTCAGGTGGCGATGTAGGTGGTAGCAAGAACTTTGAT
    GCGTTTGTAGAGCAAAAAGTAGATGTAGCTAAAGGATTCGGCATTGATGAAGATGTTGCA
    AGACGTTTAGCATCTAAATATGGTTCAAATGTTGATGAATTGTTCAACATTGCGCAAACA
    TCTCAATACCATGATAGCAAGTTACCATTAGAAATTTATGTAGAACTTGTTTATAGTATT
    CAACAAGAAATGGTATACAAACCTAACGATTTCTTAGTTCGTCGTTCTGGTAAAATGTAT
    TTCAATATTAAAGATGTATTAGATTATAAAGATGCTGTCATCGATATTATGGCAGATATG
    CTTGATTACTCTCCAGCTCAAATTGAAGCATATACTGAAGAAGTTGAGCAAGCAATTAAA
    GAAGCGCAACATGGAAATAATCAACCAGCAGTTAAAGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1722

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_1209 [new locus tag: NWMN_RS06800 ]
  • symbol: GlpD
  • description: aerobic glycerol-3-phosphate dehydrogenase
  • length: 573
  • theoretical pI: 8.22968
  • theoretical MW: 64491
  • GRAVY: -0.477487

Function[edit | edit source]

  • reaction:
    EC 1.1.5.3?  ExPASy
    Glycerol-3-phosphate dehydrogenase sn-glycerol 3-phosphate + a quinone = glycerone phosphate + a quinol
  • TIGRFAM:
    Metabolism Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, A subunit (TIGR03377; EC 1.1.5.3; HMM-score: 174.3)
    and 26 more
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine glycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 49.6)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 36.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 31.7)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 27.1)
    Metabolism Energy metabolism Electron transport flavocytochrome c (TIGR01813; HMM-score: 23.3)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 22)
    Metabolism Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 19.3)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 18.9)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 18.2)
    lycopene cyclase family protein (TIGR01790; HMM-score: 17.9)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 16.8)
    Cellular processes Cellular processes Detoxification alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 15.9)
    Cellular processes Cellular processes Adaptations to atypical conditions alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 15.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other tyrosine decarboxylase MnfA (TIGR03812; EC 4.1.1.25; HMM-score: 14.6)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, monomeric form (TIGR01377; HMM-score: 14.1)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 13.4)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, beta subunit family (TIGR01373; HMM-score: 12.5)
    Metabolism Energy metabolism TCA cycle succinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 12.1)
    Metabolism Energy metabolism Anaerobic succinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 12.1)
    Metabolism Energy metabolism Aerobic succinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 12.1)
    Metabolism Energy metabolism TCA cycle succinate dehydrogenase, flavoprotein subunit (TIGR01816; HMM-score: 11.8)
    putative aminophosphonate oxidoreductase (TIGR03329; HMM-score: 11.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis enzyme (TIGR00292; HMM-score: 11.5)
    Metabolism Energy metabolism Electron transport thioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 11.1)
    Cellular processes Cellular processes Detoxification mercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 9.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other C-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 9.4)
  • TheSEED:  
    Carbohydrates Sugar alcohols Glycerol and Glycerol-3-phosphate Uptake and Utilization  Aerobic glycerol-3-phosphate dehydrogenase (EC 1.1.5.3)
    and 2 more
    Fatty Acids, Lipids, and Isoprenoids Phospholipids Glycerolipid and Glycerophospholipid Metabolism in Bacteria  Aerobic glycerol-3-phosphate dehydrogenase (EC 1.1.5.3)
    Respiration Electron donating reactions Respiratory dehydrogenases 1  Aerobic glycerol-3-phosphate dehydrogenase (EC 1.1.5.3)
  • PFAM:
    NADP_Rossmann (CL0063) DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 195.8)
    and 11 more
    no clan defined DAO_C; C-terminal domain of alpha-glycerophosphate oxidase (PF16901; HMM-score: 83.8)
    NADP_Rossmann (CL0063) FAD_binding_3; FAD binding domain (PF01494; HMM-score: 28.6)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 27.8)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 23.6)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 22.9)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 17.7)
    Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 16.9)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 16.2)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 15.9)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 12.7)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 11)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.009107
    • TAT(Tat/SPI): 0.009773
    • LIPO(Sec/SPII): 0.001542
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MWDKSLVFTFFRRRFGMALSTFKREHIKKNLRNDEYDLVIIGGGITGAGIALDASERGMKVALVEMQDFAQGTSSRSTKLVHGGLRYLKQFQIGVVAETGKERAIVYENGPHVTTPEWMLLPMHKGGTFGKFSTSIGLGMYDRLAGVKKSERKKMLSKKETLAKEPLVKKEGLKGGGYYVEYRTDDARLTIEVMKRAAEKGAEIINYTKSEHFTYDKNQQVNGVKVIDKLTNENYTIKAKKVVNAAGPWVDDVRSGDYARNNKKLRLTKGVHVVIDQSKFPLGQAVYFDTEKDGRMIFAIPREGKVYVGTTDTFYDNIKSSPLTTQEDRDYLIDAINYMFPSVNVTDEDIESTWAGIRPLIYEEGKDPSEISRKDEIWEGKSGLLTIAGGKLTGYRHMAQDIVDLVSKRLKKDYGLTFSPCNTKGLAISGGDVGGSKNFDAFVEQKVDVAKGFGIDEDVARRLASKYGSNVDELFNIAQTSQYHDSKLPLEIYVELVYSIQQEMVYKPNDFLVRRSGKMYFNIKDVLDYKDAVIDIMADMLDYSPAQIEAYTEEVEQAIKEAQHGNNQPAVKE

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: CcpA regulon
    CcpA(TF)important in Carbon catabolism; RegPrecise    transcription unit transferred from N315 data RegPrecise  

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]