From AureoWiki
Jump to navigation Jump to search

NCBI: 06-JUL-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_2189 [new locus tag: NWMN_RS12635 ]
  • pan locus tag?: SAUPAN005754000
  • symbol: ureB
  • pan gene symbol?: ureB
  • synonym:
  • product: urease subunit beta

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_2189 [new locus tag: NWMN_RS12635 ]
  • symbol: ureB
  • product: urease subunit beta
  • replicon: chromosome
  • strand: +
  • coordinates: 2410293..2410703
  • length: 411
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    ATGATACCAGGAGAAATTATTACAAAAAGTACAGAGGTTGAAATTAATAACCATCATCCT
    GAAACAGTTATCGAAGTTGAAAATACAGGAGATCGACCAATTCAAGTGGGCTCACATTTT
    CATTTTTATGAAGCAAATGCAGCATTAGATTTCGAACGTGAAATGGCATATGGAAAACAT
    TTAGATATTCCAGCTGGAGCAGCTGTTCGATTTGAACCTGGGGATAAAAAAGAAGTTCAA
    TTAGTTGAATATGCTGGCAAACGTAAAATTTTTGGTTTTCGTGGTATGGTCAATGGTCCT
    ATCGATGAGTCACGTGTCTATCGCCCAACTGATGAAAATGATGAATATGCAGGTGTATTC
    GGAGATAACGGTGCTGAAAACGTGAATAAAAAAGGAAGAAAAAGATCATGA
    60
    120
    180
    240
    300
    360
    411

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_2189 [new locus tag: NWMN_RS12635 ]
  • symbol: UreB
  • description: urease subunit beta
  • length: 136
  • theoretical pI: 5.29359
  • theoretical MW: 15263.8
  • GRAVY: -0.755147

Function[edit | edit source]

  • reaction:
    EC 3.5.1.5?  ExPASy
    Urease Urea + H2O = CO2 + 2 NH3
  • TIGRFAM:
    Metabolism Central intermediary metabolism Nitrogen metabolism urease, beta subunit (TIGR00192; EC 3.5.1.5; HMM-score: 150.2)
  • TheSEED:  
    Amino Acids and Derivatives Arginine; urea cycle, polyamines Urea decomposition  Urease beta subunit (EC 3.5.1.5)
    and 1 more
    Urease subunits  Urease beta subunit (EC 3.5.1.5)
  • PFAM:
    no clan defined Urease_beta; Urease beta subunit (PF00699; HMM-score: 146.9)
    and 1 more
    PapD-like (CL0556) PapD_N; Pili and flagellar-assembly chaperone, PapD N-terminal domain (PF00345; HMM-score: 12.2)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.004773
    • TAT(Tat/SPI): 0.000229
    • LIPO(Sec/SPII): 0.000375
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MIPGEIITKSTEVEINNHHPETVIEVENTGDRPIQVGSHFHFYEANAALDFEREMAYGKHLDIPAGAAVRFEPGDKKEVQLVEYAGKRKIFGFRGMVNGPIDESRVYRPTDENDEYAGVFGDNGAENVNKKGRKRS

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]